DOI: 10.
18585/inabj.
Immunomodulatory Activity of Dioscorea esculenta L.
(Puspitaningrum I, et al.
Indones Biomed J.
: 307-16
RESEARCH ARTICLE
Immunomodulatory Effect of Dioscorea esculenta L.
on NF-B.
TLR-4.
TNF-, and IL-10 Expressions in LPS-stimulated RAW 264.
7 Mouse Macrophages Ika Puspitaningrum1,2.
MuthiAo Ikawati3.
Nanang Fakhrudin4,5.
Arief Nurrochmad6,E Faculty of Pharmacy.
Universitas Gadjah Mada.
Sekip Utara.
Yogyakarta 55281.
Indonesia.
Sekolah Tinggi Ilmu Farmasi Yayasan Pharmasi Semarang (STIFAR).
Jl.
Letnan Jendral Sarwo Edie Wibowo Km.
Semarang 50192.
Indonesia Department of Pharmaceutical Chemistry.
Faculty of Pharmacy.
Universitas Gadjah Mada.
Sekip Utara.
Yogyakarta 55281.
Indonesia Department of Pharmaceutical Biology.
Faculty of Pharmacy.
Universitas Gadjah Mada.
Sekip Utara.
Yogyakarta 55281.
Indonesia Medicinal Plants and Natural Products Research Center.
Faculty of Pharmacy.
Universitas Gadjah Mada.
Sekip Utara.
Yogyakarta 55281.
Indonesia Department of Pharmacology and Clinical Pharmacy.
Faculty of Pharmacy.
Universitas Gadjah Mada.
Sekip Utara.
Yogyakarta 55281.
Indonesia *Corresponding author.
Email: ariefnr@ugm.
Received date: Mar 14, 2025.
Revised date: June 5, 2025.
Accepted date: June 12, 2025 Abstract ACKGROUND: Gene expressions of toll-like receptor 4 (TLR)-4, nuclear factor-kappaB (NF-B), tumor necrosis factor (TNF)-, and interleukin (IL)-10 are known to have roles in the inflammatory process and affect the regulation of the immune system.
A preliminary study showed that Dioscorea esculenta L.
tuber has immunomodulatory activity against macrophage phagocytosis activity and lymphocyte proliferation.
However, the immunomodulatory activity of aqueous extract (AE), polysaccharide fraction (PF), and non-polysaccharide fraction (NPF) of D.
esculenta L.
tubers on these gene expressions have not been elucidated well.
Therefore, this study was performed to determine its immunomodulatory activity by utilizing RAW 264.
7 cell culture induced by lipopolysaccharide (LPS).
METHODS: RAW 264.
7 cells were stimulated with LPS at a concentration of 1 AAg/mL for 30 minutes before incubation with non-toxic concentrations of AE.
PF.
NPF, positive control, and inulin at 25 and 50 AAg/mL.
TNF-.
IL-10.
TLR-4.
NF-B,
and -actin expressions were evaluated using reverse transcription-polymerase chain reaction (RT-PCR) and were normalized with -actin as an internal control.
Triplicate experiments were performed throughout this study.
RESULTS: Treatment with 25 AAg/mL NPF significantly decreased the expression of NF-B.
TLR-4, and TNF- .
<0.
contrast, treatment of 25 and 50 AAg/mL PF significantly decreased the NF-B expression .
<0.
Moreover, only treatment with 50 AAg/mL AE exhibited a significant increase in IL-10 expression .
<0.
CONCLUSION: Treatment with D.
esculenta L.
tuber stimulated macrophage RAW 264.
7 cells via NF-B.
TLR-4.
TNF-, and IL-10 expressions.
NPF at 25 AAg/mL has stronger immunomodulatory activity in reducing the expression of genes involved in the inflammatory process that plays a role in regulating the immune system.
KEYWORDS: Dioscorea esculenta L.
Immunomodulator.
IL-10.
NF-B.
TLR-4.
TNF-.
RAW 264.
7 cell Indones Biomed J.
: 307-16
Introduction The growing prevalence of diseases makes the body more susceptible to bacterial and viral infections.
When the immune system is exposed to substances that are considered foreign, there will be two types of immune responses, namely the innate immune response and the adaptive immune response.
Macrophages are important members of the innate immune system and, together with neutrophils, eosinophils, and natural killer (NK) cells, are the first line of defense to identify, eliminate, or attack toxic microorganisms and macromolecules.
Macrophages are one of the immune cells that can express toll-like receptor Copyright A 2025 The Prodia Education and Research Institute.
This work is licensed under a Creative Commons Attribution-NonCommercial 4.
0 International (CC-BY-NC) License.
The Indonesian Biomedical Journal.
Vol.
No.
June 2025, p.
Print ISSN: 2085-3297.
Online ISSN: 2355-9179 (TLR)-4 receptors that can recognize lipopolysaccharide (LPS) endotoxin from Gram-negative bacteria.
It will further signal transduction via TLR-4 and activate the innate immune response, and stimulate various proteins that are important for macrophage function.
TLR-4 can stimulate the production of the transcription factor nuclear factor kappaB (NF-B), which produces various proteins and a number of inflammatory cytokines such as tumor necrosis factor (TNF)-, and interleukins (IL) that play a role in the immune response.
The immune system can be boosted through exercise, adequate rest, and a balanced diet.
A particular group of nutrients or foods can provide health benefits by influencing immunological and inflammatory parameters, which are clinically and experimentally proven .
eferred to as immunonutrient.
The immunonutrients in immunomodulators are part of the strategy to modulate the immune response.
Immunomodulators are substances that can affect or alter the immune response in the body.
Immunonutrients can be sourced from natural products such as tubers, a local food ingredient that some people usually consume instead of rice.
Several studies have demonstrated that tubers contain immunonutrients, including dietary fiber, antioxidants, prebiotics, vitamins, and minerals, all of which are known to enhance the health of the digestive tract and support the immune .
Due to their multipharmacological properties, including immunomodulatory and antioxidant effects, natural products and their active metabolites have garnered considerable attention recently as an alternative.
Natural products and their active metabolites play a crucial role in treating immunological diseases by modifying immune .
Dioscorea esculenta L.
, or also known as Gembili tubers, are a type of tuber that contains immunonutrients and has been proven to strengthen the immune system.
esculenta tubers' water-soluble polysaccharide (PLA or soluble dietary fibe.
content gives them immunostimulant and prebiotic properties.
Compared to Dioscorea alata tubers.
esculenta tubers have substantially greater quantities of inulin, with values of 23.
21% per gram of extract.
Glucomannan was found to be 39.
present in D.
esculenta tubers in water extract.
Nonpolysaccharide bioactive substances, such as dioscorine and diosgenin, which can act as immunostimulants, are also present in D.
esculenta tubers.
In a preliminary study that we conducted, the aqueous extract (AE), polysaccharide fraction (PF), and nonpolysaccharide fraction (NPF) of D.
esculenta L.
found to enhance macrophage phagocytosis activity, with the highest activity observed at 100 g/mL AE, 100 g/ mL PF, and 12.
5 g/mL NPF.
AE.
PF, and NPF were also demonstrated to increase lymphocyte proliferation activity, with the most significant enhancement noted at 12.
5 g/mL AE, 12.
5 g/mL PF, and 50 g/mL NPF.
The previous research was performed on the expression of D.
esculenta L.
genes, especially as an immunomodulator.
Therefore, this study was conducted as a follow-up investigation to determine the immunomodulatory activity of the AE.
PF, and NPF of D.
esculenta L.
on TLR-4.
NFB.
TNF-, and IL-10 gene expressions, which play roles in the inflammatory process and affect the regulation of the immune system.
This study was conducted by utilizing RAW 264.
7 macrophage cell culture in vitro, induced by LPS using the reverse transcription-polymerase chain reaction (RT-PCR) method.
Methods esculenta Extract Preparation Fresh D.
esculenta L.
tubers were procured from Gundi and Ledokdawan Village.
Geyer.
Grobogan.
Central Java.
The tubers were selected for their freshness and maturity, having been harvested 8 to 9 months after planting.
esculenta L.
plant was identified and authenticated by a scientific officer at the Department of Pharmaceutical Biology.
Faculty of Pharmacy.
Universitas Gadjah Mada.
Yogyakarta.
The voucher specimens were deposited in the herbarium (No.
4/UN1/FFA.
2/BF/PT/2.
The tubers of D.
esculenta L.
were peeled, cleaned, and chopped into small pieces while running water.
After that, they were combined with hot water at 80 to 90AC in a 1:4 ratio.
Next, the mixture was filtered to obtain the filtrate, which was then cooled.
The filtrate obtained is hereinafter referred to as the AE of D.
esculenta L.
A freeze-dryer was used to partially dry this water extract.
A 96% ethanol was used to further precipitate the D.
esculenta L.
aqueous extract.
This solution was stored in a freezer at approximately -10AC for 18 hours until a precipitate It was then thawed at 8AC for 2 hours and drawn with a vacuum pump to obtain more precipitate.
A freezedryer was employed to dry the precipitate, which pertains to the PF of D.
esculenta L.
Meanwhile, a vacuum rotary evaporator concentrated the filtrate for 6Ae7 hours at 60AC.
Subsequently, a freeze dryer was utilized to dry the viscous portion, which is referred to as the NPF of D.
From the extraction and fractionation of D.
DOI: 10.
18585/inabj.
Immunomodulatory Activity of Dioscorea esculenta L.
(Puspitaningrum I, et al.
Indones Biomed J.
: 307-16
tubers, the yields for AE.
PF, and NPF were 2.
00%, and 2.
75%, respectively.
Fourier Transform Infrared Analysis Freeze-dried AE.
PF, and NPF were characterized by their functional groups using Fourier Transform Infrared (FTIR) Model 630 (Agilent Technology.
Santa Clara.
CA.
USA) at a wavenumber of 4000Ae400 cmAA .
ithout using KB.
, with Inulin (Sigma-Aldrich.
St.
Louis.
MO.
USA) as a comparison standard.
The criteria for identifying Auinulin-likeAy compounds can be observed in the FTIR spectrum, with an important peak in the characteristic inulin band around 935 cmOe1.
Cell Culture The Parasitology Laboratory of the Faculty of Medicine.
Universitas Gadjah Mada, provided the RAW 264.
7 cells.
Incubated at 37AC with a 5% CO2 supply, the cells were kept in the complete medium consisting of Dulbecco's Modified Eagle's Medium (DMEM) (Cat.
No.
Gibco.
Waltham.
MA.
USA), 10% fetal bovine serum (Cat.
No.
Sigma-Aldric.
, and 1% penicillinstreptomycin (Cat.
No.
Gibc.
Cell Viability The cells were plated at a density of 4.
0 y 103 cells per well in 96-well plates, with 100 AAL per well, and incubated in a CO2 incubator at 37AC for 24 hours.
The media was discarded, and 100 AAL of AE.
PF.
NPF, a positive control (Imboost, a commercial product containing 250 mg of Echinacea purpurea.
PT Soho Global Health.
Jakarta.
Indonesi.
, and inulin (Sigma-Aldric.
were added at concentrations of 25, 50, 100, and 300 AAg/mL.
Next, the media was discarded again, and 100 AAL of MTT .
,5-dimethyl2-thiazoly.
-2,5-diphenyl-2H-tetrazolium bromid.
(Bio Basic.
Markham.
ON.
Canad.
was added.
After 4 hours, 100 AAL of 10% SDS (Merck.
Rahway.
NJ.
USA) in 0.
N HCl was added as a stopper.
Following another 24 hours of incubation, absorbance was measured using a microplate reader (Bio-Rad.
Hercules.
CA.
USA) at a wavelength of 550 nm.
RNA Extraction and cDNA Synthesis Cells were plated at a density of 1.
0 y 106 cells per well in 24-well plates and stimulated with LPS (Sigma-Aldric.
at 1 g/mL for 30 minutes before incubation with non-toxic concentrations of AE.
PF.
NPF, positive control, as well as 25 and 50 g/mL inulin.
Total RNA was isolated from the cells using the Total RNA Mini Kit (Geneaid.
New Taipei City.
Taiwa.
A reverse transcription system comprising 2 AAL of 5x RT Master MIX (ReverTra AceA Toyobo.
Osaka.
Japa.
, 2 AAg of total RNA, and 6 AAL of RNase-free water was used to transform the total RNA into cDNA.
The reaction was conducted for 15 minutes at 37AC, then incubated for 5 minutes at 50AC, and finally heated for 5 minutes at 98AC.
The concentration of the synthesizing cDNA was measured using a NanoDrop instrument (NanoQuant Plate.
Tecan Spark.
Mynnedorf.
Switzerlan.
Gene Expression Analysis The expression levels of the TNF-.
IL-10.
TLR-4, and NF-B were analyzed by taking 2.
0 AAL of cDNA at a concentration of 100 ng/AAL and combining it with 28.
0 AAL
of PCR Master Mix (GoTaq Green.
Promega.
Madison.
WI.
USA).
This mixture contained 15.
0 AAL of Master Mix, 1 AAL of forward primer, 1 AAL of reverse primer, and 11.
of DNase/RNase-free water.
The gene expression levels of TNF-.
IL-10.
TLR-4.
NF-B and -actin were determined using RT-PCR.
A thermal cycler (Bio-Ra.
was used to apply the following conditions: denaturation at 95AC for one 45 PCR cycles at 95AC for 10 seconds, 55AC for 30 seconds, and 72AC for 20 seconds.
and final steps at 95AC for 15 seconds, 60AC for 30 seconds, and 95AC for 15 seconds.
PCR products were analyzed by electrophoresis using 2% agarose and FluoroVueE (Nucleic Acid Gel Stain.
SMOBIO Technology.
Hsinchu City.
Taiwa.
at 10,000X, catalog number NS1000, in a 500 AAL vial as a dye.
Gels were visualized using densitometry with Gel-Doc (BioRa.
Band density was evaluated using ImageJ software (NIH.
Bethesda.
MD.
USA).
TNF-.
IL-10.
TLR4, and NF-B expression levels were normalized with -actin as an internal control.
Primer sequences were based on algorithm-generated sequences from Primer Bank:
http://pga.
edu/primerbank .
ccessed on 24 September 2.
, by entering the target gene ID primerbank on the website by selecting the mouse species.
The primers for the TNF-.
IL-10.
TLR-4.
NF-B and -actin genes are listed in Table 1.
Statistical Analysis Triplicate experiments were performed throughout this study.
Data from all experiments are presented as meanAstandard error of the mean (SEM).
One-way analysis of variance or the KruskalAeWallis test was employed to determine the signiAcance between the groups.
Statistical analysis was performed using SPSS version 23 (IBM Corporation.
Armonk.
NY.
USA), and p<0.
05 indicated statistically signiAcant differences.
Print ISSN: 2085-3297.
Online ISSN: 2355-9179 The Indonesian Biomedical Journal.
Vol.
No.
June 2025, p.
Table 1.
Mouse oligonucleotide primer sequences used in reverse transcriptase-PCR.
Gen
TNF-
IL-10
TLR-4
NF- B
-actin Results Primer Type Sequence .
AIe 3A) Forward
cTCACACTCAGATCATCTTCT
Reverse GCTACGACGTgCTACAG
Forward
GCTCTTACTGACTGGCATGAG
Reverse CGCAGCTCTAGGAGCATGTG
Forward
ATGGCATGGCTTACACCACC
Reverse GAGGCCAAtGTCTCCACA Forward ATGGCAGACGATGATcTAC Reverse TGTTGACAGTGGTAtCTGGTG Forward GGCTGTATTcTCCATCG Reverse CCAGTTGGTAACAATGCCATGT Effects of AE.
PF, and NPF on the Viability of RAW264.
7 Cells The RAW 264.
7 cell viability test, when administering AE.
PF, and NPF, indicated a reduction in the number of viable cells as the concentration increased.
The AE.
PF, and NPF groups at concentrations of 25 AAg/mL and 50 AAg/mL exhibited an average cell viability above 80%.
However, in the groups with concentrations of 100 AAg/mL and 300 AAg/ mL, the average cell viability dropped below 80%.
In the Size (BP) positive control group, which included a commercial product containing 250 mg of E.
purpurea, all tested concentrations, namely 25, 50, 100, and 300 AAg/mL, showed an average cell viability exceeding 80%.
The inulin group consistently maintained an average viability above 80% at 25 AAg/mL and 50 AAg/mL concentrations (Figure .
Effects of AE.
PF, and NPF on TLR-4 Expression in LPS-stimulated RAW 264.
7 Cells The effects of AE.
PF, and NPF on TLR-4 were assessed after LPS treatment and activation.
As shown in Figure 2, the expression of TLR-4 in the negative group was higher Viability of RAW 264.
7 (%)
A 50
A 00
PF 0
PF 0
N 00
N 5
N 50
N 100
In 30 In 25 In in 5 In 10 Po n 3 Po ive Po tive Po ve 1 Figure 1.
The cellular viability measurements using the MTT assay.
The RAW 264.
7 cells were incubated with various concentrations of AE.
PF, and NPF, along with a positive control for 24 hours, and 1 g/mL LPS as a negative control.
Each histogram represents the meanASEM from n=3.
*Significant differences were compared with LPS .
<0.
Immunomodulatory Activity of Dioscorea esculenta L.
(Puspitaningrum I, et al.
Indones Biomed J.
: 307-16
DOI: 10.
18585/inabj.
Relative TLR-4 to -actin
TLR-4
129 bp -actin 154 bp 1 AAg/mL LPS than in the normal group .
<0.
This result indicates that LPS can promote TLR-4 expression.
Treatment of NPF at 25 and 50 AAg/mL, inulin at 25 AAg/mL, and the positive control at 25 and 50 AAg/mL significantly decreased TLR-4 expression in LPS-stimulated RAW 264.
7 cells .
<0.
Figure 2.
Effects of AE.
PF, and NPF on cytokine TLR-4 mRNA expression in LPS-stimulated RAW 264.
The values are expressed as the meansASEM of results obtained from at least three independent experiments.
*Significant differences were compared with LPS .
<0.
LPS can enhance NF-B expression.
As shown in Figure 3, treatment of PF at 25 and 50 AAg/mL.
NPF at 25 AAg/mL, inulin at 25 AAg/mL, and the positive group at 25 and 50 AAg/ mL significantly decreased in NF-B in LPS-stimulated RAW 264.
7 cells .
<0.
Effects of AE.
PF, and NPF on TNF- Expression in LPS-stimulated RAW 264.
7 Cells The effects of AE.
PF, and NPF on the pro-inflammatory cytokine TNF- were assessed following LPS treatment and activation.
A significant difference was observed when comparing the negative and normal groups .
<0.
This indicates that the presence of LPS can enhance the Effects of AE.
PF, and NPF on NF-B Expression in LPS-stimulated RAW 264.
7 Cells The effects of AE.
PF, and NPF on NF-B expression were evaluated after LPS treatment and activation.
A significant difference was observed when comparing the negative and normal groups .
< 0.
This indicates that the presence of Relative NFkB to -actin 111 bp NFkB 154 bp -actin 1 AAg/mL LPS Figure 3.
Effects of AE.
PF, and NPF on NF-B mRNA expression in LPSstimulated RAW 264.
7 cells.
The values are expressed as the meansASEM of results obtained from at least three independent experiments.
*Significant differences were compared with LPS .
<0.
Print ISSN: 2085-3297.
Online ISSN: 2355-9179 The Indonesian Biomedical Journal.
Vol.
No.
June 2025, p.
Relative TNF- to -actin
N 5
In 50
In 25
TNF-
61 bp -actin 154 bp 1 AAg/mL LPS Figure 4.
Effects of AE.
PF, and NPF on cytokine pro-inflammation TNF- mRNA expression in LPS-stimulated RAW 264.
7 cells.
The values are expressed as the meansASEM of results obtained from at least three independent *Significant differences were compared with LPS .
<0.
Fourier Transform Infrared Analysis (FT-IR) Results FT-IR characterization revealed peaks at specific wave numbers identifying inulin, supported by the standard inulin (Figure .
These characteristic absorption bands include the O-H vibration stretching at a wave number of 3268.
88 cmAA, the C-H stretching vibration of the alkane chain at a wave number of 2925.
96 cmAA, the C-O-C stretching vibration of the ring at a wave number of 1123.
80 cmAA, residual -D-Glucopyranosyl in the carbohydrate chain at a wave number of 933.
70 cmAA, followed by 2-ketofuranose at wave 20 and 812.
56 cm-1.
,19,.
The criteria for identifying Auinulin-likeAy compounds can be observed in the FT-IR spectrum, with an important peak in the characteristic inulin band around 935 cmAA.
Figure 6 and Table 2 indicated that D.
esculenta L.
PF contained an inulin-like compound, expression of the TNF-.
As shown in Figure 4, treatment of NPF at 25 AAg/mL, inulin at 25 AAg/mL, and the positive group at 25 and 50 AAg/mL significantly decreased TNF- in LPS-stimulated RAW 264.
7 cells .
<0.
Effects of AE.
PF, and NPF on IL-10 Expression in LPSstimulated RAW 264.
7 Cells The effects of AE.
PF, and NPF on the anti-inflammatory cytokine IL-10 were assessed following LPS treatment and A significant difference was observed between the negative and normal groups .
<0.
This indicated that the presence of LPS can decrease IL-10 expression.
The treatment of AE at 50 AAg/mL and positive control at 25 AAg/mL significantly increased IL-10 expression in LPSstimulated RAW 264.
7 cells .
<0.
(Figure .
Relative IL-10 to -actin
N 5
In 50
In 25
IL-10
105 bp -actin 1 AAg/mL LPS 154 bp Figure 5.
Effects of AE.
PF, and NPF on cytokine anti-inflammation IL-10 mRNA expression in LPS-stimulated RAW 264.
7 cells.
The values are expressed as the meansASEM of results obtained from at least three independent *Significant differences were compared with LPS .
<0.
Immunomodulatory Activity of Dioscorea esculenta L.
(Puspitaningrum I, et al.
Indones Biomed J.
: 307-16
DOI: 10.
18585/inabj.
NPF
Transmittance (%) Wavenumber .
Figure 6.
FT-IR spectra of inulin standard.
AE.
PF, and NPF.
Black arrows indicate important peaks in the characteristic inulin band.
in the outer cell membrane of gram-negative bacteria and can activate macrophages by triggering cellular signaling .
LPS induced inflammatory cytokines in RAW 264.
7 macrophage cells through the mediation of TLR-4 and NF-B signaling pathways.
Binding of LPS to TLR-4 induces phosphorylation and ultimately activates NF-B, a factor that regulates DNA transcription to control the expression of genes coding for proteins involved in various biological processes.
Cellular stimulation will then induce the transcription of pro-inflammatory genes by producing pro-inflammatory cytokines such as TNF-.
These cytokines can activate nearby non-specific cells, promoting bacterial phagocytosis.
based on the similarity of the functional groups with the inulin standard and PF has an important peak in the characteristic inulin band, namely 926 cmAA.
Discussion The RAW 264.
7 cell line is a monocyte-macrophage cell line widely used in immune system research due to its similarity to macrophages produced by bone marrow.
These RAW 264.
7 cells were derived from mice induced by the Abelson murine leukemia virus.
In this research.
LPS was used to activate RAW 264.
7 cells.
LPS is found Table 2.
Wavenumbers of AE.
PF.
NPF, and inulin standard.
Wavenumber .
No.
Inulin
Standard
NPF
Functional Groups O-H
Asymmetric C-H
Stretching vibration C-O-H
C-O-C
C-O
Residual -D-Glcp in the carbohydrate chain 2-ketofuranose The Indonesian Biomedical Journal.
Vol.
No.
June 2025, p.
Print ISSN: 2085-3297.
Online ISSN: 2355-9179 Innate immune cells utilize both positive and negative feedback mechanisms, some of which are facilitated by cellto-cell communication, to regulate inflammatory responses.
A well-known example is IL-10, a negative regulator that plays a crucial role in reducing and managing inflammation.
IL-10 limits the activity of antigen-presenting cells and adaptive immune responses, and it also inhibits the synthesis of pro-inflammatory cytokines and chemokines.
The negative regulatory mechanisms of IL-10 are difficult to distinguish due to their complex interactions with other regulatory elements.
For instance, the primary paracrine signals that regulate inflammatory responses in macrophages and dendritic cells, including IL-10 generation, are TNF and interferon (IFN)-, which are activated following TLR4 stimulation.
Strict regulation of the inflammatory response is necessary for immune homeostasis.
This is how the immune system is modulated.
This study started by cultivating RAW 264.
cells in media until they reached confluence.
Only cell viability between 80% and 95% was utilized for further Concentrations that lead to a viability below 80% are considered toxic to the cells.
In this study, macrophages remained viable at 80% with AE.
PF, and NPF at concentrations of 25 and 50 g/mL, indicating that AE.
PF, and NPF at both concentrations are safe for cell However, 100 and 300 AAg/mL concentrations of AE.
PF, and NPF were considered toxic to LPS-induced RAW 264.
7 cells, as their viability dropped below 80%.
Subsequently, 25 and 50 AAg/mL concentrations of AE.
PF.
NPF, inulin, and the positive control were chosen for gene expression analysis.
Studies on the toxicity test of AE.
PF, and NPF of D.
esculenta L.
, both in vitro and in vivo, have not been conducted until now.
However, in previous studies, namely the cytotoxic test of ethanol extract, polar fraction, and semi-polar fraction of D.
esculenta L.
on MCF7 cancer cells, it was shown that the higher the concentration of the treated sample .
5 g / mL), the number of living cells decreased.
The results showed that AE at 25 and 50 AAg/mL could not significantly decrease the expression of the proinflammatory genes TLR-4.
NF-B, and TNF-.
However.
AE at 50 AAg/mL can significantly increase the expression of the anti-inflammatory gene IL-10.
While previous studies on the activity of D.
esculenta L.
tubers concerning IL-10 gene expression have not been conducted, research has focused on the immunomodulatory effects of D.
alata L.
ne family with D.
esculenta L.
, demonstrating that the methanol extract of these tubers can promote the up-regulation of IL-10 and IL-4, as well as down-regulation of nitric oxide (NO).
IL-2, interferon (IFN)-.
TNF-, prostaglandin E2 (PGE.
levels, and cyclooxygenase (COX) activities.
PF at 25 and 50 AAg/mL can only significantly decrease the NF-B gene expression.
NPF at 25 AAg/mL showed a significant decrease in TLR-4.
NF-B, and TNF-.
This is thought to be caused by several metabolite contents that are extracted when the water extract is precipitated using 96% Ethanol is a solvent with high solubility .
ielectric constant .
, so it is helpful in dissolving all substances, both polar and semipolar.
Based on previous research, the semipolar fraction of D.
esculenta L.
terpenoids, saponins, alkaloids, and phenolics.
In the ethanol extract of D.
esculenta L.
, saponin compounds have also been isolated.
In the phytochemical preliminary screening that we have conducted, it was shown that the non-polysaccharide fraction of D.
esculenta L.
alkaloids and saponins.
These compounds are thought to play a role in immunomodulatory activity.
Total saponins from Dioscorea collettii have been shown to reduce cytokine production by inhibiting the activation of the TLR4/NF-B signaling pathway.
Alkaloids are also thought to act as immunostimulants by increasing the production of IL-2 and lymphocyte proliferation in culture.
Activated lymphocyte cells will activate cytokines such as IL-2 and IFN-.
These cytokines will activate macrophages to respond to antigens in the body.
However, alkaloids can also be cytotoxic, which can cause immunosuppressive activity.
This is what is thought to cause an increase in NPF concentration not accompanied by an increase in effect.
NPF at 50 AAg/mL can only significantly reduce the TLR-4 gene expression.
In addition, it is suspected that there is an interaction between the metabolites contained so that no effect appears when the concentration is increased.
This often occurs in natural materials, because the compound components they contain are not single but consist of various chemical compounds, where these components work together to cause a response.
However, with increasing concentration, the number of chemical compounds contained increases, so that there is a possibility of adverse interactions that cause a decrease in the function of the compound content.
Further research is necessary to better understand the mechanism that makes the relationship between concentration and response non-linear.
In the present study, positive controls used a commercial product containing 250 mg of E.
DOI: 10.
18585/inabj.
Immunomodulatory Activity of Dioscorea esculenta L.
(Puspitaningrum I, et al.
Indones Biomed J.
: 307-16
and inulin.
The results showed that E.
purpurea can cause downregulation of TLR-4.
NF-B, and TNF-, along with an upregulation of IL-10.
This result reveals a molecular mechanism in E.
purpurea that produces anti-inflammatory activity, enabling it to act as an immunomodulator.
This conclusion is supported by previous research.
extract was found to increase the immune response through activation of the NF-B and MAPK pathways associated with TLR-4, thereby increasing the expression of immunomodulators such as iNOS.
COX-2, mPGES-1.
IL-2.
IL-6.
IL-10.
IL-1.
IFN-, and TNF-.
This suggests that the extract can be considered a potential immunostimulating agent or functional food.
A polysaccharide called fructan, which has a chain length of 2Ae60 units, is what inulin is.
This fiber is categorized as one that dissolves in water but is indigestible by digestive enzymes.
This study demonstrated that inulin decreased the expression of the TLR-4.
NF-B, and TNF- genes but did not increase the expression of the IL-10.
This result is supported by a previous study, which indicates that inulin influences the immune system in several ways.
By inhibiting the NF-B.
ERK 1/2, and JNK pathways, it contributes to IgA secretion.
This, in turn, lowers pro-inflammatory molecules (IL-6.
IL-12, p40, and TNF-) by inducing lymphocytes and dendritic cells and boosts immunological responses by activating the complement system.
Inulin also stimulates immune cells in Peyer's patches, leading to IL-10 production and activating cytotoxic NK cells.
According to FT-IR analysis.
PF shows similarities in functional groups to standard inulin, indicating that PF contains inulin-like compounds.
In this study.
PF did not demonstrate immunomodulatory activity comparable to standard inulin, specifically in terms of downregulating TLR-4.
NF-B, and TNF-.
This is believed to be because PF does not contain pure inulin, which means it can only provide one of the immunomodulatory activities: the downregulation of NF-B expression.
These results can serve as a basis for further studies on inulin isolation and its effectiveness in reducing TLR-4.
NF-B, and TNF-.
Based on the results of the study, it was shown that the NPF treatment group at 25 g/mL was the most potent in reducing the expression of TLR-4.
NF-B, and TNF- This is in line with the TLR-4 and NF-B signaling pathways, where when these signaling pathways are lowered, the production of TNF- proinflammatory cytokines also However, further research is needed to confirm the immunomodulatory activity of EA.
PF, and NPF after administration in an in vivo model induced by an antigen.
Conclusion This study provides evidence that AE.
PF, and NPF from esculenta L.
tubers demonstrate immunomodulatory activity through different molecular pathway mechanisms.
NPF at 25 g/mL was the most potent in reducing the expression of TLR-4.
NF-B, and TNF- genes.
PF at 25 and 50 g/mL can lower the expression of the NF-B gene.
Additionally.
AE at 50 g/mL increased the expression of the anti-inflammatory IL-10 gene.
These findings indicate that D.
esculenta L.
tubers possess the potential to function as a natural immunomodulator for the development of functional food or nutraceuticals.
Acknowledgments This research was supported by Direktorat Penelitian.
Universitas Gadjah Mada under Hibah Rekognisi Tugas Akhir (Grant No.
4971/UN1.
P1/PT.
01/2.
Authors Contribution IP was involved in plant collection, processing, and experimental work.
AN.
NF, and MI supervised the overall IP is involved in the conceptualization and writing.
AN.
NF, and MI reviewed and edited the manuscript.
All authors read and agreed to the final version of manuscript.
References