Tangkari KA, et al.
Anti-apoptotic activity of Urtica dioica.
Modulation of Caspase-3 Expression and Spermatogenic Cells by Urtica dioica Extract in Obesity-Induced Male Rats Kabir Ardiansyah Tangkari1,2.
Jurnalis Gempaning Tyas1,2.
Harni Sutiani1,3.
Zaenudin1,4*.
Dicky Mochammad Rizal5.
Jajar Setiawan5 Postgraduate of Biomedical Science.
Faculty of Medicine.
Public Health and Nursing.
Universitas Gadjah Mada.
Yogyakarta.
Indonesia, 2Bachelor of Medicine Program.
Faculty of Medicine.
Universitas Muhammadiyah Metro.
Lampung.
Indonesia, 3Department of Midwifery.
Politeknik Kesehatan Kemenkes Pontianak.
West Kalimantan.
Indonesia, 4Department of Nursing.
Akademi Keperawatan Al-Ikhlas.
Bogor.
West Java.
Indonesia, 5Department of Physiology.
Faculty of Medicine.
Public Health and Nursing Universitas Gadjah Mada.
Yogyakarta.
Indonesia https://doi.
org/10.
22146/inajbcs.
ABSTRACT
Submitted: 2025-09-08 Accepted : 2026-01-05 Obesity is associated with impaired steroidogenesis and spermatogenesis through mechanisms involving hypogonadism, inflammation, and oxidative stress.
Proinflammatory cytokines such as tumor necrosis factor- (TNF-) contribute to apoptotic signaling pathways, including caspase-3 activation, leading to germ cell Urtica dioica contains bioactive compounds with reported antioxidant and anti-apoptotic properties.
This study aimed to evaluate the effects of U.
extract on TNF- and caspase-3 mRNA expression as well as spermatogenic cell counts of the testes of obese male Sprague Dawley rats.
This experimental study employed a post-test-only control group design using 25 rats divided into five groups: healthy control (C.
, obese control induced by a high-fat and fructose diet (C.
, and three intervention groups receiving U.
dioica extract at doses of 125 mg/ kg (D.
, 250 mg/kg (D.
, and 500 mg/kg (D.
for four weeks.
The results showed no significant differences in TNF- mRNA expression were observed between the intervention groups and the obese control.
In contrast, caspase-3 mRNA expression was significantly reduced in all U.
dioicaAetreated groups compared with the obese control.
No significant differences were observed in the number of primary or secondary spermatocytes among groups.
However, spermatid counts were significantly higher in D2 and D3 groups compared with the obese In conclusion.
dioica extract demonstrated potential anti-apoptotic effects and was associated with improved post-meiotic spermatogenic outcomes in obese rats.
ABSTRAK
Keywords:
Urtica dioica Obesitas berhubungan dengan gangguan steroidogenesis dan spermatogenesis melalui mekanisme yang melibatkan hipogonadisme, inflamasi, dan stres Sitokin proinflamasi seperti tumor necrosis factor- (TNF-) berperan dalam jalur pensinyalan apoptosis, termasuk aktivasi kaspase-3, yang berujung pada kehilangan sel germinal.
Urtica dioica mengandung senyawa bioaktif yang dilaporkan memiliki sifat antioksidan dan antiapoptotik.
Penelitian ini bertujuan untuk mengevaluasi pengaruh ekstrak U.
dioica terhadap ekspresi mRNA TNF- dan kaspase-3 serta jumlah sel spermatogenik pada testis tikus jantan Sprague Dawley obesitas.
Penelitian eksperimental ini menggunakan desain post-testonly control group dengan 25 ekor tikus yang dibagi ke dalam lima kelompok, yaitu kontrol sehat (C.
, kontrol obesitas yang diinduksi dengan diet tinggi lemak dan fruktosa (C.
, serta tiga kelompok intervensi yang menerima ekstrak U.
dioica dengan dosis 125 mg/kg (D.
, 250 mg/kg (D.
, dan 500 mg/kg (D.
selama empat minggu.
Hasilnya tidak terdapat perbedaan bermakna pada ekspresi mRNA TNF- antara kelompok intervensi dan kontrol obesitas.
Sebaliknya, ekspresi mRNA kaspase-3 lebih rendah secara signifikan pada seluruh kelompok intervensi dibandingkan dengan kontrol obesitas.
Tidak ditemukan perbedaan bermakna pada jumlah spermatosit primer maupun sekunder antar kelompok.
Namun, jumlah spermatid secara signifikan lebih tinggi pada kelompok D2 dan D3 dibandingkan dengan kontrol obesitas.
Sebagai simpulan, ekstrak U.
menunjukkan potensi efek antiapoptotik dan berhubungan dengan perbaikan luaran spermatogenesis tahap pascameiotik pada tikus obesitas.
*corresponding author: zaenudin0396@mail.
InaJBCS.
Volume 58.
Number 1, 2026 January:
INTRODUCTION
Obesity is a major global health problem with a rapidly increasing prevalence and has been associated not only with metabolic disorders but also with male infertility.
1Ae3 Excess visceral adiposity in obesity disrupts mechanisms, including chronic lowgrade inflammation, oxidative stress, and hormonal imbalance.
4 These alterations impair the hypothalamicAe pituitaryAegonadal axis, reduce androgen levels, and negatively affect testicular Inflammatory obesity are characterized by increased infiltration of immune cells into adipose tissue and elevated production of proinflammatory cytokines, particularly tumor necrosis factor- (TNF-).
6 Tumor necrosis factor- plays a crucial role in activating nuclear factor-B (NF-B), inducing oxidative stress, and promoting apoptosis through the activation of These pathways contribute to Sertoli and Leydig cell dysfunction, germ cell loss, and impaired spermatogenesis in obese males.
7Ae9 The inflammatory and apoptotic milieu associated with obesity highlights the need for therapeutic agents with antioxidant and antiinflammatory properties.
Urtica dioica .
tinging nettl.
, a plant belonging to the Urticaceae family, contains various flavonoids, polyphenols, vitamins, and 10 Extracts of its leaves and stems demonstrated antioxidant and anti-inflammatory activities and have been traditionally used for various medicinal purposes.
11,12 Previous studies have shown that U.
dioica extract exerts protective effects on male reproductive parameters, including sperm motility, count, morphology, seminiferous tubule diameter, testosterone levels, and testicular histology in nicotine-induced animal models.
However, the effects of U.
dioica on testicular spermatogenic cells under obesity conditions remains limited.
This study aimed to evaluate the effects of U.
extract on TNF- and caspase-3 mRNA expression, as well as on spermatogenic cell populations, in obese male Sprague Dawley rats induced by a high-fat and fructose diet.
MATERIAL AND METHODS
Study subjects This experimental study used 25 male Sprague Dawley rats aged 7Ae8 weeks with an initial body weight of 170Ae 200 g.
All experimental procedures were approved by the Medical and Health Research Ethics Committee of the Faculty of Medicine.
Public Health, and Nursing.
Universitas Gadjah Mada.
Yogyakarta (No.
KE/FK/0956/EC/2.
Urtica dioica was taxonomically identified at the Faculty of Biology.
Universitas Gadjah Mada.
Yogyakarta (No.
0172/STb/ XI/2.
Preparation of U.
dioica extract Leaves and stems of U.
dioica were dried at approximately 45AC and ground into a fine powder.
Extraction was carried out by maceration using 70% ethanol at room temperature for 3 y 24 hr, with solvent replacement every 24 hr.
The combined filtrates were concentrated using evaporation to obtain a crude Animal design and treatment After a 7-day acclimatization period, rats were randomly divided into five Tangkari KA, et al.
Anti-apoptotic activity of Urtica dioica.
= 5 per grou.
: healthy control (C.
, obese control receiving a high-fat and fructose diet (C.
, and intervention groups receiving U.
dioica extract at doses of 125 mg/kgBW (D.
, 250 mg/kgBW (D.
, and 500 mg/kgBW (D.
Obesity was induced for 6 weeks, followed by oral administration of U.
dioica extract in the intervention groups for 4 weeks.
Termination and organ collection Obesity induction and confirmation Semi-quantitative RT-PCR analysis Obesity was induced using a highfat and fructose diet (HFFD) formulated according to Murwani,14 consisting of standard feed .
%), wheat starch .
%), lard .
%), pure cholesterol .
%), cholic acid .
2%), and distilled water .
8%),
provided ad libitum.
In addition, pure fructose at 1% of body weight was administered daily via oral gavage, following Sunarti.
Body weight and naso-anal length were measured weekly.
Obesity was confirmed using the Lee index, calculated as the cube root of body weight .
divided by naso-anal length .
Rats with a Lee index greater than 300 were classified as obese.
Approximately 30 mg of testicular tissue was used for total RNA extraction using a Favorgen RNA extraction kit, followed by RNA purity and concentration assessment using NanoVue Plus.
Complementary DNA .
DNA) was synthesized using ReverTra AceA qPCR RT Kit II (ToyoboA).
Intervention with U.
dioica extract Following obesity induction, rats in groups D1AeD3 received U.
dioica extract dissolved in 2 mL of distilled water and administered orally via gavage once daily for 4 weeks.
Control groups received standard feed without extract At the end of the experimental period .
, rats were fasted for approximately 10 hours and anesthetized intramuscularly with ketamine .
mg/ kgBW).
Testes were collected through surgical procedures for subsequent molecular and histological analyses.
Gene expression of TNF- and caspase-3 was analyzed using semiquantitative polymerase chain reaction .
qRT-PCR) with specific primers (TABLE .
PCR
amplification was performed for 40 cycles, consisting of denaturation at 94AC, annealing at 62AC, and extension at 72AC.
PCR products were separated on 2% agarose gel electrophoresis at 100 V, visualized using a Syngene G:BOX gel documentation system, and analyzed for band density using ImageJ Relative mRNA expression was calculated using the following formula:
Relative expression = Target gene band density/GAPDH band density TABLE 1.
Target gene primers for research Gen Primer forward .
AoAe3A.
Primer reverse .
AoAe3A.
Caspase-3
CCGACTTCCTCTATGCTTACTC
CGTACAGtCAGCATGGC
TNF-
aTgCTcTCTCATCAGTTC
TCTGCTTGGTGGtGCTACGAC
GAPDH
AGTGCCAGCCTCGTCTCATA
ATGAAgTCGTTGATGGC InaJBCS.
Volume 58.
Number 1, 2026 January:
Histological examination Testicular tissues were fixed in 10% buffered neutral formalin (BNF) for 24 hours and processed for paraffin embedding, including trimming .
, graded dehydration .
Ae100%), xylene clearing, embedding, and sectioning at a thickness of 3Ae5 AAm using a rotary Sections were stained with HematoxylinAeEosin
(HE)
standard histological procedures.
Spermatogenic cell populations .
rimary spermatocytes, secondary spermatocytes, and spermatid.
were evaluated by a single experienced For each animal, three randomly selected seminiferous tubules were examined at 400 x magnification.
Each assessment was repeated three times per sample, and the mean value was used for statistical analysis.
Statistical analysis Data were analyzed using SPSS Normality was assessed with the ShapiroAeWilk test and homogeneity of variance with LeveneAos test.
Normally distributed data .
Ou 0.
were analyzed using one-way ANOVA followed by LSD post-hoc test, while non-normally distributed data were analyzed using the KruskalAeWallis test followed by the MannAeWhitney test.
Results were considered statistically significant at p O
RESULTS
The mRNA expression of TNF- The mRNA expression of TNF- .
was normalized to GAPDH .
(FIGURE .
The data were normally distributed and homogeneous .
> One-way ANOVA demonstrated a significant difference in TNF- expression among groups .
= 0.
Post-hoc LSD analysis revealed that TNF- expression in the obese control group (C2= 1.
20 A 1.
was significantly higher than in the healthy control group (C1= 1.
02 A 0.
p = 0.
Administration of U.
dioica extract in the intervention groups D1 .
18 A 0.
D2 .
16 A 0.
and D3 .
15 A 0.
resulted in lower mean TNF- expression compared with C2.
however, these differences did not reach statistical significance .
> No significant differences were observed among the intervention groups (FIGURE .
FIGURE 1.
Representative electrophoresis image of RT-PCR products of TNF-/ GAPDH Tangkari KA, et al.
Anti-apoptotic activity of Urtica dioica.
The mRNA expression of caspase-3 Caspase-3 mRNA expression .
was normalized to GAPDH .
(FIGURE .
The data were not normally distributed .
< 0.
, and KruskalAe Wallis analysis showed a significant difference among groups .
= 0.
Pairwise analysis using the MannAe Whitney test indicated that caspase-3 expression in the obese control group (C2= 1.
05 A 0.
was higher than in the healthy control group (C1= 1.
, although the difference was not statistically significant .
= 0.
contrast, administration of U.
extract significantly reduced caspase-3 expression in all intervention groups, including D1 .
79 A 0.
p = 0.
D2 .
63 A 0.
p = 0.
, and D3 .
A 0.
p = 0.
, compared the obese control group.
Significant differences were also observed among the intervention groups .
= 0.
(FIGURE .
Spermatogenic cell counts Primary identified by their relatively large cell and nuclear size with abundant Spermatids were characterized by elongated morphology, smaller nuclei, scant cytoplasm, and darker staining.
Spermatogenic cells were quantified from hematoxylinAeeosin (HE)Aestained testicular sections at 400y magnification in three randomly selected seminiferous tubules (FIGURE .
FIGURE 2.
Comparison of mean A SD mRNA expression of TNF-/ GAPDH across FIGURE 3.
Representative electrophoresis image of RT-PCR products of caspase-3/GAPDH InaJBCS.
Volume 58.
Number 1, 2026 January:
FIGURE 4.
Comparison of mRNA expression of caspase-3/GAPDH across groups .
ean A SD) Secondary spermatocytes Spermatids Primary spermatocytes Lengths 0.
FIGURE 5.
Histological images of spermatogenic cells in testicular samples stained with HematoxylinAeEosin (HE) at 400y Tangkari KA, et al.
Anti-apoptotic activity of Urtica dioica.
TABLE 2.
Mean number .
ean A SD.
of spermatogenic cells with and without U.
dioica extract administration.
Group Primary spermatocyte count Number of secondary Number of 60A15.
40A28.
40A19.
60A4.
20A11.
60A13.
20A7.
60A14.
00A10.
60A11.
80A19.
60A6.
40A11.
60A13.
20A3.
Notes: .
p<0.
05 compared with C1.
p<0.
05 compared with C2.
p<0.
compared with D1.
The numbers of primary and secondary spermatocytes were normally distributed .
> 0.
One-way ANOVA demonstrated a significant difference in the number of primary spermatocytes among groups .
= 0.
, whereas no significant difference was observed for secondary spermatocytes .
= Post-hoc analysis showed that the obese control group (C2= 34.
had significantly fewer primary spermatocytes compared with the healthy control group (C1= 55.
p = 0.
Although U.
administration increased the mean number of primary spermatocytes in D1 .
20 A 7.
and D3 .
40 A 11.
compared with C2, these increases were not statistically significant .
> 0.
significant differences were observed among the intervention groups .
>0.
The number of spermatids was not normally distributed .
< 0.
KruskalAe Wallis analysis revealed a significant difference among groups .
= 0.
MannAeWhitney analysis showed that the obese control group (C2= 40.
60 A 13.
had significantly fewer spermatids compared with the healthy control group (C1= 78.
40 A 19.
p = 0.
Administration of U.
dioica extract significantly increased spermatid counts in D2 .
60 A 6.
p = 0.
and D3 .
20 A 3.
p = 0.
compared with C2, whereas the increase observed in D1 .
00 A 10.
was not statistically significant .
= 0.
Significant differences were observed among the intervention groups .
= 0.
Overall, caspase-3 mRNA expression was significantly lower, and spermatid numbers were significantly higher, in obese male rats treated with U.
In contrast, its effects on TNF- expression and primary spermatocyte counts were modest and did not reach statistical significance, while secondary DISCUSSION Effect of U.
dioica extract on TNF- mRNA expression Obesity is associated with chronic low-grade alterations, and increased reactive oxygen species (ROS), all of which adversely affect the male reproductive In this study.
TNF- mRNA expression differed significantly among groups, with the obese group (C.
showing higher expression compared with the healthy control group (C.
This finding is consistent with Kolb et al.
,18
InaJBCS.
Volume 58.
Number 1, 2026 January:
who reported that obesity activates JNK and NF-B signaling pathways, thereby promoting inflammatory responses.
Administration of U.
dioica extract in the intervention groups (D1.
D2, and D.
did not significantly alter TNF- mRNA expression compared with the obese control group.
Although the mean TNF- values in the intervention groups were numerically lower than those in C2, these differences were not statistically significant.
This finding differs from previous studies reporting significant TNF- suppression following dioica supplementation, which may be attributed to longer intervention durations in those studies.
19,20 The relatively high variability observed in TNF- expression in the present study may also have limited the ability to detect statistically significant Nevertheless, the known anti-inflammatory dioica, including inhibition of NFB activation, suppression of NADPH oxidaseAemediated ROS production, and enhancement of antioxidant enzyme activity, remain biologically plausible.
12,21
Effect of U.
dioica extract on caspase-3 mRNA expression Oxidative stress and inflammation associated with obesity have been implicated in disruption of the hypothalamicAepituitaryAegonadal (HPG) axis and induction of germ cell apoptosis.
In the present study, caspase-3 mRNA expression did not differ significantly between the obese control (C.
and healthy control (C.
groups, indicating that obesity induction under the current experimental conditions did not result in a detectable increase in caspase-3 transcription at baseline.
Despite the absence of a significant baseline difference, administration of dioica extract significantly reduced caspase-3 mRNA expression in all intervention groups compared with the obese control group.
This finding suggests that U.
dioica may exert an anti-apoptotic effect in the testis independent of marked baseline apoptotic activation.
This effect is likely related to the flavonoid content of U.
dioica, particularly quercetin, which has been shown to attenuate apoptosis by suppressing caspase-3 activity.
Supporting evidence from Hossain et al.
demonstrated that quercetin reduced caspase-3 expression and apoptosis in pancreatic -cells of hyperglycemic Additionally, reduced ROS levels and enhanced antioxidant enzyme activity may contribute to inhibition of the intrinsic apoptotic pathway in germ
23,24
Effect of U.
spermatogenic cells This study identified significant differences in spermatogenic cell spermatid stage, while earlier germ cell stages were less affected.
Obese rats exhibited significantly lower numbers of spermatids compared with healthy controls, consistent with previous reports that obesity increases testicular germ cell apoptosis.
In the intervention groups, there was no significant difference in the number of primary or secondary spermatocytes compared with the obese control group.
In contrast, spermatid counts were significantly higher in the D2 and D3 groups.
These findings indicate that U.
dioica extract was associated with increased spermatid numbers rather than generalized enhancement of spermatogenesis across all developmental stages.
A possible explanation for this stage-specific effect is that post-meiotic germ cells, such as spermatids, are more susceptible to oxidative stress and apoptosis, and therefore may benefit more readily from antioxidant and anti-apoptotic Similar improvements Tangkari KA, et al.
Anti-apoptotic activity of Urtica dioica.
in spermatogenic outcomes following dioica administration have been reported by Jalili et al.
,13 in nicotineinduced testicular injury models.
Several limitations should be First, the lack of a significant difference in caspase-3 expression between the healthy and obese control groups suggests that the obesity model or its duration may not have induced robust baseline apoptotic activation at the transcriptional level.
Second, the high variability observed in TNF- expression may have limited statistical power to detect treatmentrelated differences.
Third, the absence protein-level histological apoptosis markers restricts to mRNA expression Future studies incorporating additional molecular and histological endpoints are warranted.
Overall, this study demonstrates that dioica extract was associated with reduced caspase-3 mRNA expression and increased spermatid counts in obese male rats, while its effects on TNF- expression and earlier spermatogenic cell populations were limited under the present experimental conditions.
ACKNOWLEDGMENT