Integrative of SNP Array and Transcriptomic Analysis for BCSC Biomarkers (Margaret AL, et al.
Indones Biomed J.
: 373-81
DOI: 10.
18585/inabj.
RESEARCH ARTICLE
FOXO1 and FYN Expression Trends in Breast Cancer Stem Cells:
An Integrative Study of Single Nucleotide Polymorphism (SNP) Array and Quantitative PCR .
PCR) Analysis Ay Ly Margaret1.
Septelia Inawati Wanandi2,3,E.
Fadilah Fadilah4.
Rafika Indah Paramita4 Doctoral Program in Biomedical Sciences.
Faculty of Medicine.
Universitas Indonesia.
Jl.
Salemba Raya No.
Jakarta 10430.
Indonesia Molecular Biology and Proteomics Core Facilities.
Indonesian Medical Education and Research Institute (IMERI).
Faculty of Medicine.
Universitas Indonesia.
Jl.
Salemba Raya No.
Jakarta 10430.
Indonesia Department of Biochemistry and Molecular Biology.
Faculty of Medicine.
Universitas Indonesia.
Jl.
Salemba Raya No.
Jakarta 10430.
Indonesia Bioinformatics Core Facilities.
Indonesian Medical Education and Research Institute (IMERI).
Faculty of Medicine.
Universitas Indonesia.
Jl.
Salemba Raya No.
Jakarta 10430.
Indonesia *Corresponding author.
Email: septelia.
inawati@ui.
Received date: Apr 13, 2025.
Revised date: Jun 21, 2025.
Accepted date: Jul 7, 2025 Abstract ACKGROUND: Currently, identification of breast cancer stem cells (BCSC.
commonly relies on CD24-/CD44 expression profiles.
However, few studies have integrated genomic mutation data with experimental gene expression validation in CSC and non-CSC populations.
Genotyping results of CD24-/CD44 MDAMB-231 cells revealed 36 mutations in BCSCs compared to non-BCSCs, with upregulated FOXO1 and FYN that might represent promising candidate biomarkers for this subpopulation.
Therefore, in this study, single nucleotide polymorphism (SNP) and quantitative polymerase chain reaction .
PCR) analysis were performed to assess the association between mutations and expression trends of FOXO1 and FYN in MDAMB-231 cell, as breast cancer cell model with stem-like traits and well-characterized profile.
METHODS: Genomic DNA was isolated from BCSC and non-BCSC DNA from the MDAMB-231 cell line.
Mutation analysis was conducted using PLINK, while gene expressions of FOXO1 and FYN were quantified by one-step SYBR Greenbased qPCR, using 18s rRNA as a reference.
Data was then analyzed with the Livak .
OeOIOIC.
RESULTS: Among 36 mutations found in BCSCs of the MDAMB-231 cell line.
PTEN .
and CHEK2 .
were identified as pathogenic.
While FOXO1 .
989A2.
817 vs.
072A0.
and FYN .
405A0.
072 vs.
855A0.
mRNA levels were found to be higher in CSCs compared to non-CSCs, though these differences was not statistically significant.
CONCLUSION: Pathogenic mutations in CHEK2 and PTEN were detected within BCSC population, implying a potential influence on the expression of FOXO1 and FYN, though not statistically significant.
These findings suggest a possible, but as yet unverified, association between gene mutations and expression patterns, emphasizing the importance of further functional studies to validate FOXO1 and FYN as biomarkers for BCSCs.
KEYWORDS: breast cancer stem cells.
FOXO1.
FYN.
PTEN.
CHEK2, mutation, biomarker Indones Biomed J.
: 373-81
Introduction Breast cancer is one of the most commonly diagnosed malignancies among women and remains the leading contributor to cancer-related deaths worldwide.
Emerging evidence highlights that breast cancer stem cells (BCSC.
are pivotal in reducing treatment efficacy, promoting disease relapse, and facilitating metastatic .
These BCSCs represent a small population of malignant cells that resemble normal stem cells in function but possess a markedly higher capacity to initiate tumors.
Copyright A 2025 The Prodia Education and Research Institute.
This work is licensed under a Creative Commons Attribution-NonCommercial 4.
0 International (CC-BY-NC) License.
The Indonesian Biomedical Journal.
Vol.
No.
August 2025, p.
The presence of BCSCs predicts a poor prognosis .
, with some underlying causes of BCSCs include DNA mutations.
Currently, the identification of breast cancer stem cells commonly relies on cluster of differentiation CD24-/CD44 expression profiles and aldehyde dehydrogenase (ALDH) However, ongoing research is still assessing the precision and selectivity of these markers.
Therefore, our previous study attempted to search for BCSCs biomarker candidates from the secretome.
Cells emit a mixture of molecules called the secretome to communicate and alter their environment, which may impact cancer development.
Understanding how cells communicate via signaling pathways may be critical to identifying distinct markers for BCSCs.
High-throughput single nucleotide polymorphism (SNP) array technologies enable the detection of genetic alterations that may regulate the secretome.
Specific mutations have been shown to correlate with secretome components in breast cancer stem cells.
Since only few studies have integrated genomic mutation data with experimental gene expression validation in CSC and nonCSC populations, the present study integrated genomic and proteomic approaches to explore the association between gene mutations and secretome-derived biomarkers as potential indicators of BCSCs.
The previous genotyping results of CD24-/CD44 MDAMB-231 cells revealed 36 mutations in BCSCs compared to non-BCSCs, with upregulated Forkhead box protein O1 (FOXO.
and Fyn proto-oncogene Src family tyrosine kinase (FYN) that might represent promising candidate biomarkers for this subpopulation.
FOXO1
functions as a transcription factor involved in apoptosis, oxidative stress response, and metabolic control, while FYN, a non-receptor tyrosine kinase, modulates signaling pathways linked to cell adhesion and migration.
Both are essential in maintaining CSC phenotypes, including quiescence, plasticity, and resistance to environmental Hence, this current studyAos framework focuses on FOXO1 and FYN, two proteins with critical roles in cellular Recent studies have highlighted the importance of characterizing expression patterns in CSCs, given their roles in tumor initiation, progression, and resistance to therapy.
This study was conducted to enhance early detection strategies and inform the development of CSCtargeted therapies by examining how pathogenic mutations, particularly in Phosphatase and TENsin homolog (PTEN) and Checkpoint kinase 2 (CHEK.
that might influence the relative expression of FOXO1 and FYN in CSC-enriched Print ISSN: 2085-3297.
Online ISSN: 2355-9179 compared to the non-CSC subpopulations.
This study combined SNP array and qualitative quantitative polymerase chain reaction .
PCR) analysis to explore the association between mutations and expression trends of FOXO1 and FYN in the MDAMB-231 model, as a basis for identifying candidate biomarkers.
MDAMB-231 cell line was utilized as it is known as breast cancer cell model with stem-like traits and well-characterized profile.
This integrative analysis aimed to uncover novel mechanistic insights and potential targets in breast cancer stem cell biology.
Methods Cell Culture and Isolation of BCSC and Non-BCSC CD24A/CD44A (BCSC.
and CD24A/CD44A .
on-BCSC.
were isolated from the MDAMB-231 cell line using flow cytometry with CD24 PE-A and CD44 FITC-A markers.
MDAMB-231 cells were obtained from the Laboratory of Biochemistry and Molecular Biology.
Faculty of Medicine.
Universitas Indonesia.
Initially.
BCSCs were cultured in serum-free Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F.
medium (Gibco.
Waltham.
MA.
USA), while non-BCSCs were maintained in DMEM supplemented with 10% fetal bovine serum (FBS) (Gibc.
Both were supplemented with 30 mM sodium bicarbonate (NaHCO.
, 1% Amphotericin B, and 1% Penicillin/ Streptomycin.
Once both cell populations reached 70Ae80% confluency, they were cultured in serum-free DMEM/F12 medium for 24 hours, followed by cell harvesting.
DNA Isolation DNA was isolated from each cell culture using the Genomic DNA mini kit for blood/cultured cell (GB100/300.
Gene Aid.
New Taipei City.
Taiwa.
Then, the DNA isolates were quantified using a Nanodrop at the absorbance ratio of 260/280 for concentration accuracy.
Double-stranded DNA .
sDNA) was quantified using the Qubit 3.
0 fluorometer combined with the Broad Range (BR) assay kit (Thermo Fisher Scientific.
Waltham.
MA.
USA).
Preparation of a Microarray for DNA Mutation Analysis The concentration of each isolate DNA in the SNP array study was adjusted to 50 ng/AAL before processing with the Infinium Asian Screening Array (ASA)-24v1.
0, a genotyping panel featuring 659,184 SNP markers tailored for Asian populations.
Microarray steps include amplification, enzymatic fragmentation, alcohol precipitation.
DNA resuspension, hybridization, incubation, followed by DOI: 10.
18585/inabj.
Integrative of SNP Array and Transcriptomic Analysis for BCSC Biomarkers (Margaret AL, et al.
Indones Biomed J.
: 373-81
enzymatic extension, fluorescence staining, and iScan Illumina reading of fluorescence intensity.
Bioinformatics Analysis of Microarray The output data from the tool is in the form of .
idat files for each sample, which are then analyzed using the gtc to vcf software to convert the .
idat files into .
vcf before performing control analysis using PLINK .
ttps:// com/freeseek/gtc2vc.
ttps://z.
plink/).
The desired quality control screening thresholds for genotyping studies are as follows: genotyping rate (>98%).
SNP missingness (<0.
, individual missingness (<0.
minor allele frequency (MAF.
>0.
Hardy-Weinberg Equilibrium (HWE.
<0.
, heterozygosity rate deviation (<.
Genetic mutations that passed quality control (QC) were then analyzed using single nucleotide variants (SNV) Detailed SNP analysis for mutation detection was performed on post-QC data with a p-value<0.
01 using PLINK .
to generate data .
bim, .
bed, .
The final mutation list was cross-validated using the Catalogue of Somatic Mutations in Cancer (Cosmi.
database to confirm clinical relevance and known oncogenic profiles .
ttp://cancer.
uk/cosmic/).
In silico Analysis for Candidate Biomarkers Secretome of BCSCs GSE7513 and GSE7515 gene expression profiles were acquired from the gene expression omnibus (GEO) database .
ttps://w.
gov/geo/browse/), provides access to high-throughput gene expression datasets along with relevant biological annotations.
GSE7513
comprises 14 CD24-/CD44 and 15 non-CD24-/CD44 , while GSE7515 comprises 15 cancer mammospheres and 11 non-mammosphere primary breast cancer, respectively.
Differentially expressed genes (DEG.
were selected based on a |Log2 fold chang.
>1.
0 and a p-value<0.
For the enrichment gene ontology study.
Enrichr software was utilized .
ttps://maayanlab.
cloud/Enrichr/).
Proteinprotein interactions were further analyzed using the String database .
ttps://string-db.
org/).
The interaction significance was determined based on a combined score range of 0.
Cytoscape software version 3.
ttps://cytoscape.
org/) was used as a visualization and network analysis tool to interpret protein interaction networks.
Subsequent analysis involved hub node filtering based on centrality assessment using five components: degree (D), betweenness centrality (BC), closeness centrality (CC), stress (S), and average shortest path length (ASPL).
K-means clustering was applied during the in-silico validation process.
,13,.
RNA Isolation and RNA Concentration Measurement Total RNA was extracted using TriPure isolation reagent (ATB2700-.
, following the manufacturer's instructions, to ensure high-quality RNA suitable for downstream gene expression analysis.
RNA purity and concentration were assessed by Nanodrop One Spectrophotometer (Thermo Scientifi.
, ensuring RNA integrity for qPCR.
qPCR Analysis qPCR was conducted using SYBR Green chemistry to quantify the FOXO1.
FYN, and 18S as an internal control for normalization in the comparison between CSC and nonCSC groups (Table .
The reaction mixture consisted of 5 AAL of 2y SensiFAST SYBR Master Mix (One step ki.
, 1 AAL of reverse transcriptase enzyme, 0.
2 AAL of RNase inhibitor, 0.
4 AAL each of 10 AAM forward and reverse primers, 9 AAL of DEPC-treated RNase-free water (BIO-72.
, and 2 AAL of RNA .
ontaining 100 ng of template RNA), making a final reaction volume of 10 AAL.
The amplification protocol was optimized as follows: incubation at 45AC for 10 min, an initial denaturation at 95AC for 2 min, followed by 40 cycles of amplification at 95AC for 5 s and 60AC for 30 s, with a final extension at 60AC for 1 min.
All samples were analyzed in triplicate.
The expression profiles of FOXO1 and FYN were analyzed using the Livak .
-OIOIC.
method with 18S as an internal control.
Results Genotyping Analysis Results In this genotyping analysis with SNP arrat, a search was conducted for mutations in the BCSCs (CD24-/CD44 ) from the MDAMB-231 cell line.
Based on the parameters used, there were 36 different mutations in BCSC (ACP3.
USP17L15.
PPID.
LINC02899.
TXLNB.
STX5.
LRRIQ1.
DHX37.
CDH2.
SERPINB11.
MRI1.
ZNF687.
FH.
MSH6.
SCN1A.
TTN.
CPS1.
RAF1.
CC2D2A.
APC.
SYNE1.
BRCA.
DNAH11.
KCNH2.
TG.
CDH23.
PTEN.
CHEK2.
MYBPC3.
CDON.
PKP2.
EXOSC8.
PSEN1.
SNHG14.
PAFAH1B1, and GAA) compared to non-BSCS.
Three of Table 1.
Primer sequences.
Primer Forward .
Ao-3A.
Reverse .
Ao-3A.
aCGGCTACCACATCCAAG
CCTCCAATGGATCCTCGTTA
FYN
AGTTGCGCCATCTGTCAGGA
AACCTCGCCTCTACTCTCGC
FOXO1 AGACAACGACACATAGCTGG
AgAGTTGGTGaGACAT The Indonesian Biomedical Journal.
Vol.
No.
August 2025, p.
Print ISSN: 2085-3297.
Online ISSN: 2355-9179 Table 2.
Pathogenic mutation in CSC of the cell line MDAMB231.
Mutation Gene
Chromosome Position Alel
Changes Mutation Type
PTEN
G>C
Splice
CHEK2
A>T
Splice and 11 edges (Figure 3B).
The medium confidence cut-off 40, identifying key nodes through interactions, with protein-protein interactions filtered by Stringdb score 0.
Based on the centrality analysis results, two candidate upregulated protein biomarkers found in the secretome are FOXO1 and FYN (Table .
the 36 mutations were pathogenic (BRCA.
CHEK2, and PTEN).
Of the three pathogenic mutations identified, this study focused on CHEK2 .
on NM_007194 and PTEN .
on NM_000314 because both were involved in pathways that regulate FOXO1 and FYN, such as Phosphoinositide 3-kinase (PI3K)/Protein Kinase B (AKT) and DNA damage response.
Their roles in stemness, cell proliferation, and therapy resistance in BCSCs made them more relevant for expression analysis.
BRCA, although pathogenic, was not prioritized due to its broader link to hereditary breast cancer and lack of direct association with the target genes.
Verification through the Cosmic database indicated that PTEN was a recognized somatic mutation, while CHEK2 was not listed as a documented somatic mutation in the database.
PTEN, a phosphatase gene on chromosome 10, commonly mutates, with X27_splice .
being an oncogenic truncating mutation (Table 2 and Figure .
CHEK2, a tumor suppressor and intracellular kinase, with X107_splice .
was a truncating mutation in a tumor suppressor gene (Table 2 and Figure .
This confirmed the pathogenic characteristics of these to genes that might be oncologic.
Upregulated Expression of FOXO1 and FYN In Figure 4, the findings regarding the differences in FOXO1 and FYN expression levels between CSC and nonCSC groups were presented.
FOXO1 mRNA expression was higher in CSCs .
989A2.
compared to non-CSCs .
072A0.
(Figure .
FYN also showed elevated mRNA expression in CSCs .
405A0.
compared to non-CSCs .
855A0.
The data distribution for FOXO1 and FYN mRNA expression was normal .
>0.
, but the differences mentioned above were not statistically significant based on the independent t-test analysis .
>0.
Discussion In this study.
MDAMB 231 was selected as the sole in vitro model for triple-negative breast cancer (TNBC) due to its stem-like traits and well-characterized profile.
This cell line is highly invasive and metastatic.
It shows a mesenchymal phenotype with over 90% CD24A/CD44A cells, traits associated with cancer stemness.
Compared to other TNBC cell lines.
MDAMB 231 is extensively studied FOXO1 and FYN as Candidate Protein Biomarkers Secretome of BCSCs We identified 681 and 1294 up-regulated genes in GSE7513 and GSE7515, respectively.
A Venn diagram displayed 65 common DEGs (Figure 3A), with a network of 11 nodes PTEN Mutations PTEN Exon 1 5Ao Exon 9 3Ao X27_splice PTEN_C2 Figure 1.
PTEN analysis results.
Normal structure of the PTEN gene.
B: PTEN gene mutations shown with Lollipop Plot.
Integrative of SNP Array and Transcriptomic Analysis for BCSC Biomarkers (Margaret AL, et al.
Indones Biomed J.
: 373-81
CHECK2 Mutations X107_splice FHA
Pkinase GSE7513
GSE7515
DOK4
FYN
Figure 2.
CHEK2 analysis A: Normal structure of the CHEK2 gene.
CHEK2
gene mutations shown with Lollipop Plot.
CHEK2 is upregulated in early cancer stages, regulating cell proliferation, but downregulation later diminishes its control over cancer stem cells.
In parallel.
PTEN inactivation is linked to tumor development in various cancers, including breast cancer.
PTEN, a phosphatase gene on chromosome 10, commonly mutates, with X27_splice .
being an oncogenic truncating mutation.
Truncating mutations in PTEN can lead to different forms of C-terminally truncated PTEN proteins, affecting its phosphatase function and regulation of the PI3K/AKT pathway.
PTEN regulates cell motility, growth, survival, and DNA repair by converting dephosphorylating phosphatidylinositol 3,4,5-trisphosphate (PIP.
to phosphatidylinositol 4,5-bisphosphate (PIP.
, inhibiting the PI3K/AKT pathway.
Its loss promotes uncontrolled growth, stem-like states, drug resistance, and cancer progression.
PTEN regulates cell movement through its lipid and protein phosphatase activity, involving Rac1.
Src kinases .
ncluding FYN), and the PI3K/AKT/ mTOR pathway.
c-Src participates in proliferation, differentiation, survival, and migration.
PTEN diminishes Akt activity by PIP3 to PIP2, limiting the proliferation of TRIO
MBP
and well-characterized, offering consistent, reproducible Both CHEK2 and PTEN are well-established tumor suppressor genes known to regulate essential cellular processes such as DNA repair, cell cycle arrest, and apoptosis, mechanisms frequently disrupted in cancer.
CHEK2, a tumor suppressor and intracellular kinase, has germline mutations on chromosome 22 linked to increased risks of breast, prostate, and colorectal cancers.
The CHEK2 X107_splice .
is a truncating mutation in a tumor suppressor gene, and therefore is likely oncogenic.
CHEK2, increases breast cancer risk by affecting cell cycle arrest.
DNA repair, and apoptosis.
CHEK2
expression slows cell growth, promoting senescence and apoptosis, which reduces cancer cell survival.
CHEK2
phosphorylates proteins like p53, which is upregulated in early cancer stages.
CHEK2 mutations link to breast cancer development, as its decreasing expression during tumor progression diminishes regulatory control over cancer stem CHEK2 expression is crucial for regulating cellular responses to DNA damage, leading to cell cycle arrest.
DNA repair, or apoptosis depending on damage A50kb
59 - 59
68 - 68
4- 3
3 45 6
32 - 319
DOI: 10.
18585/inabj.
ZBTB16
AKT3
Figure 3.
Analysis of candidate BASP1
FKBP5
FOXO1
DDIT4
EBF1
protein biomarkers secretome for BCSCs.
A: Venn diagram depicted the common up-regulated genes .
og2FC|>1.
p<0.
K-means clustering of 11 upregulated proteins using the STRING online database.
The Indonesian Biomedical Journal.
Vol.
No.
August 2025, p.
Print ISSN: 2085-3297.
Online ISSN: 2355-9179 Table 3.
Centrality measurement of the two up-regulated.
Protein
Up-regulated Description ASPL
FOXO1
Forkhead box O1
FYN
Src family tyrosine kinases BC: betweenness centrality.
CC: closeness centrality.
D: degree.
S: stress.
ASPL: average shortest path length.
glioblastoma stem cells while facilitating c-Src activation.
PTEN mutations decrease PTEN activity, activating the PI3K/AKT pathway and promoting cancer growth and .
Active AKT phosphorylates FOXO1, leading to its degradation and reduced tumor suppression function.
FOXO1 activates sex determining region Y-box 2 (SOX.
, triggering its transcription in feedback loop.
FOXO1 regulates Octamer-binding transcription factor 4 (OCT.
, likely enhancing cancer aggressiveness.
In this study, we observed that the relative expression of FOXO1 and FYN was higher in CSCs than in non-CSCs.
This finding is consistent with our in silico predictions, which indicated that FOXO1 and FYN are upregulated in CSCs.
FOXO1 mRNA expression in CSCs is higher than in non-CSCs .
, indicating significant transcriptional This suggests that FOXO1 is crucial in maintaining CSC stem-like characteristics, such as selfrenewal, therapy resistance, and tumor recurrence.
Consistent with previous findings.
FOXO1 has been identified as a key regulator of stem cell renewal, dormancy, and resistance to Its role in CSC biology is particularly important due to its influence on metabolic balance, apoptosis, and immune responses.
FOXO1, a tumor suppressor in cancers like breast cancer, often shows abnormal regulation in these .
Expression of FOXO1 is upregulated in metastatic TNBC.
FOXO1 regulates differentiation, survival, metabolism, stress resistance, and tumor FOXO1 interacts with CD8 T and natural killer (NK) cells, emphasizing its crucial role in immune .
FOXO1 is enriched in specific tissues and acts as a tumor suppressor.
High FOXO1 expression is linked to cancer, contributing to epithelial-mesenchymal transition (EMT) under high glucose conditions.
Elevated FOXOs enhance tumor growth, reduce apoptosis through the insulin like growth factor 1 (IGF-.
/Akt pathway, activate antioxidant enzymes, and support cancer stem cells.
A similar trend was observed in the case of FYN, where the CSC group exhibited increased mRNA expression compared to the non-CSC group.
Elevated FYN mRNA expression despite reduced protein levels in CSCs suggests complex post-transcriptional regulation.
Elevated FYN mRNA may still influence stemness through non-coding, which regulates genes like OCT4.
SOX2, and Nanog homeobox gene (NANOG).
Targeting FYNAos posttranscriptional regulators could be a promising therapy.
Src kinase inhibitors show potential in reducing CSCs, but combined targeting of transcriptional and translational pathways may be needed for sustained efficacy.
Amplification Plot
Amplification Plot
350,000
350,000
300,000
300,000
250,000
i Rn
i Rn
250,000
200,000
200,000
150,000
150,000
100,000
100,000
50,000
50,000
Cycle FOXO1 Cycle FYN Figure 4.
Representative amplification plots obtained from a 10-fold serial dilution.
A: FOXO1 gene.
B: FYN gene.
Integrative of SNP Array and Transcriptomic Analysis for BCSC Biomarkers (Margaret AL, et al.
Indones Biomed J.
: 373-81
DOI: 10.
18585/inabj.
500 Relative Expression .
, since MCF-7 is known to be more not as invasive .
FYN is more abundant in invasive breast cancer cells like MDAMB-231 than in MCF-7 or MCF-10A.
FYN
upregulation increases Snail family transcriptional repressor 1 (SNA.
expression, influencing EMT.
Furthermore.
FYN is expressed in drug-resistant cancer cells.
FOXO1 controls the transcriptional activity of FYN and facilitates fibroblast growth factor 2 (FGF.
-stimulated epithelial-mesenchymal transition through the activation of PI3K/AKT and ERK/ MAPK signaling pathways.
This study integrates SNP array and in silico analyses to identify mutations and predict stem cell-specific protein biomarkers (Figure .
This approach improves understanding of CSC-related changes and supports translational potential.
Future research should validate these findings in clinical samples to assess FOXO1 and FYN as stemness biomarkers and therapeutic targets.
FOXO1
989A2.
FYN
405A0.
072A0.
855A0.
500 0-
Non-CSC
CSC
CSC
Figure 5.
Comparison of FOXO1 and FYN relative expression between CSC and non-CSC of MDAMB-231 cell.
Analyzed with independent t-test.
FYN, a member of the Src family kinase, is known to enhance cancer cell proliferation, invasion, and drug .
FYN is classified as a non-receptor tyrosine kinase within the oncogenic protein tyrosine kinase family and contributes to cancer progression through its protumorigenic activity.
It is linked to cell motility and proliferation and is overexpressed in the MDAMB-231 cell line.
Elevated FYN expression activates PI3K/AKT, mitogen-activated protein kinase (MAPK), and signal transducer and activator of transcription (STAT) pathways, promoting cell proliferation, migration, invasion, and EMT, while inhibiting apoptosis.
In breast cancer, elevated FYN expression activates PI3K/AKT and ERK/ MAPK pathways, promotes EMT, and is more expressed in aggressive cell lines like MDAMB-231 than in MCF-7 cell CHEK2 mutation and dysfunction of CHECK2 Occurs in Failure of activity or downregulate p53 Activating PI3K/AKT and ERK/MAPK pathway FYN Increases Outcome Aggressive growth of cancer stem cells and drug-resistant cancer cells, promote cancer cells survival Conclusion MDAMB-231 cell line, implying a potential influence on the expression of FOXO1 and FYN.
Although both genes exhibited elevated mRNA levels in CSCs compared to non-CSCs, the differences were not statistically significant.
These findings suggest a possible, but as yet unverified, association between gene mutations and expression patterns, emphasizing the importance of further functional studies to validate FOXO1 and FYN as candidate biomarkers for BCSCs.
Serine/threonine-kinase domain (KD) at C-terminal region
FOXO1
Through activation of MDM2 PTEN mutation and dysfunction of PTEN Activating WNT and PTEN/PI3K pathways Activating PI3K/AKT pathways Activating PI3K/AKT pathways Controlling Irregular expression of OCT4 and SOX2 Outcome Figure 6.
Summary of CHEK2 and PTEN loss of function algorithms on FYN and FOXO1 regulation.
The Indonesian Biomedical Journal.
Vol.
No.
August 2025, p.
Acknowledgments Print ISSN: 2085-3297.
Online ISSN: 2355-9179 The authors would like to thank GEO databases for providing platforms.
Authors Contribution SIW contributed to study design, data collection, interpretation, manuscript preparation, supervision, and funding acquisition.
FF participated in data collection, study design, statistical analysis, and supervision.
RIP participated in data collection and data interpretation.
ALM contributed to study design, data collection, statistical analysis, data interpretation, manuscript preparation, literature search, and funding acquisition.
Conflict of Interest The authors declare no conflicts of interest or competing interests related to the content of this manuscript.
References