JIPK.
Volume 17 No 3 October 2025 Sinta 1 (Decree No: 158/E/KPT/2.
e-ISSN:2528-0759.
p-ISSN:2085-5842 Available online at https://e-journal.
id/JIPK JIPK
(JURNAL ILMIAH PERIKANAN DAN KELAUTAN)
Scientific Journal of Fisheries and Marine Research Article A Filterable Agent Caused the Hemorrhagic Syndrome on Giant Gourami (Osphronemus goramy Lac.
) at Yogyakarta.
Indonesia Nur Lailatul Fitrotun Nikmah* , and Murwantoko Department of Fisheries.
Faculty of Agriculture.
Universitas Gadjah Mada.
Yogyakarta.
Indonesia
Abstract
ARTICLE INFO
Received: February 09, 2025 Accepted: May 02, 2025 Published: May 31, 2025 Available online: Sep 27, 2025 *) Corresponding author:
E-mail: nur.
lailatul@ugm.
Keywords:
Hemorrhagic syndrome Osphronemus goramy Lac.
Postulate River Virus This is an open access article under the CC BY-NC-SA license .
ttps://creativecommons.
org/licenses/by-nc-sa/4.
Giant gourami (Osphronemus goramy Lac.
) is one of the important freshwater fish commodities in Indonesia.
Disease infection is one of the constraints in the production of this fish.
The mortality of giant gourami has been reported in Yogyakarta.
Indonesia.
This study describes the disease based on observations of external and internal signs, along with the histopathology of several tissues, and determine the causative agent disease.
The diseased fish were sampled from Gamping and Moyudan Districts.
Sleman Regency.
and Wates District.
Kulon Progo Regency.
The internal organs were collected and storage in fresh dan fixed forms.
Postulate river is used to prove the causative disease of the filterable agents.
Polymerase Chain Reaction (PCR) and Reverse Transcriptase PCR (RT-PCR) are applied to confirm the presence of the virus.
Sick fishes show the hemorrhage over the entire body surface, rotted fins, exophthalmia, petechiae, pale liver, visceral adhesions, and enlarged kidneys.
Histopathological analysis shows lipidosis in the liver.
bleeding in the liver, kidneys, spleen, and and multiple necrosis in the kidneys, spleen, and brain.
Based on these signs, we designated the disease to be Hemorrhagic Syndrome.
The virus was strongly suspected the causative agent, as infecting healthy fish with a bacteriafree filtrate homogenate from diseased fish organs resulted in the same clinical signs observed in a natural outbreak.
PCR tests for Megalocytivirus and EHNV, along with RT-PCR tests for VHSV.
SVCV.
TiLV.
IHNV, and IPNV, did not show any DNA bands, indicating that these viruses were not present.
A filterable agent, potentially representing a new virus species or strain, causes hemorrhagic syndrome in giant gourami.
Cite this as: Nikmah.
, & Murwantoko.
A Filterable Agent Caused the Hemorrhagic Syndrome on Giant Gourami (Osphronemus goramy Lac.
) at Yogyakarta.
Indonesia.
Jurnal Ilmiah Perikanan dan Kelautan, 17.
:698-708.
https://doi.
org/10.
20473/jipk.
Copyright A2025 Faculty of Fisheries and Marine Universitas Airlangga Nikmah et al.
/ JIPK, 17.
:698-708
Introduction The current trend in aquaculture development is towards increased intensification and commercialization of aquatic production.
The likelihood of major disease problems occurring increases as intensifying aquaculture activities.
Giant gourami (Osphronemus goramy Lac.
) is one of the important freshwater fish commodities and has been widely cultivated for consumption in several locations in Southeast Asia, including Indonesia (Slembrouck et al.
, 2.
Giant gurami can be cultured in concrete ponds, earthen freshwater ponds, and floating net cages.
The best performance of Sago strain of giant gourami was found in the floating net cages culture system (Azrita et al.
, 2.
The rapid growth of aquaculture and a prolific global trade of the live aquatic animals and their products have led to the emergence of many new diseases in fish (Patil et al.
, 2.
Aquaculture industry has been overwhelmed with its share of diseases and problems caused by parasite, bacteria, fungi, and viruses (Senthamarai et al.
, 2.
Heneguya sp.
parasitic infection was reported in snakeskin gourami Trichopodus pectoralis in Thailand (Dinh-Hung et al.
, 2.
Several species of bacteria have been reported infect on the giant gourami such as Streptococcus suis (Nguyen et al.
Aeromonas hydrophila (Febrianti et al.
, 2021.
Fitria et al.
, 2.
Nocardia sp.
(Chen et al.
, 2.
and Mycobacterium sp.
(Agriandini et al.
, 2.
The Infectious Spleen and Kidney Necrosis Virus (ISKNV) which recognized as Giant Gourami Iridovirus (GGIV) have been reported to cause mass mortality giant gourami in Indonesia (Sukenda et al.
, 2.
The ISKNV have been reported attacks in India and caused the mass mortality of gourami (Swaminathan et al.
Jaemwimol et al.
demonstrated that using artificial infection Tilapia Lake Virus (TiLV) is a novel orthomyxo-like virus causes clinical signs of infection including skin erosion, pale skin, exophthalmia and skin haemorrhage, histopathological changes of hepatocellular necrosis and syncytial formation in the liver and lymphoid depletion in the anterior kidney, and a cumulative mortality up to 100%.
The mortality of broodstock giant gourami with typical hemorrhagic clinical symptoms was reported in several places in Yogyakarta at different times.
Cases of gourami broodstock mortality with typical clinical symptoms have been reported repeatedly in Yogyakarta, but there has never been a study to confirm the causative agent.
Therefore, this study focuses on revealing the main causative agent through a mo- lecular approach.
RiverAos postulates, and histopathological images due to infection.
This study focuses on confirmation the causative agent of mortality of giant gourami broodstock in Yogyakarta using virological, molecular, and histopathological approaches.
The study determines a definite relationship between the observed clinical symptoms and the causative agent.
Materials and Methods 1 Materials 1 The equipment The equipment used are tissue dehydration (TSP-6A/TSP-6B Bioevopeak Automated Tissue Processor.
Infitek.
Chin.
, microtome (BK-2258 rotary microtome.
Bioevopeak.
Chin.
, 0.
22-AAm filter (Millipore Filter.
Merck.
German.
, centrifuge (Sorval Legend 21R.
ThermoScientific.
USA), spectrophotometer (NanoDrop 2000.
Thermo Fisher Scientific.
USA), light microscope (CX23.
Olympus Corporation.
Japa.
, and thermal cycler (TM 100.
Bio-Rad.
USA).
2 The materials The materials used are anesthetic agent (MS222.
Sigma-Aldrich.
USA), preservative agent (Ethanol.
Merck.
German.
, preservative agent (RNAlater.
Thermo Fisher Scientific.
USA), fixative agent (Formaldehide.
Merck.
German.
, histological stains (Hematoxylin and Eosin.
HiMedia.
USA).
Tryptic Soy Agar (TSA.
Merck.
German.
, paraffin (Paraffin flakes.
Indopath.
Indonesi.
, nucleic acid extraction kit (Viral Nucleic Acid Extraction Kit II VR300.
Geneaid.
Taiwa.
RNA extraction kit (High Pure RNA Isolation Kit.
Roche.
German.
RT-PCR kit (MyTaqTM One-Step RT-PCR Kit.
Bioline.
USA).
PCR master mix (MyTaqTM HS Red Mix.
Bioline.
USA), agarose gel electrophoresis reagent (Agarose.
Merck.
German.
DNA stain (FluoroSafe DNA Stain, 1st BASE.
Singapor.
, and DNA ladder .
bp DNA Ladder.
Geneaid.
Taiwa.
3 Ethical approval The dissection and utilization of giant gourami (Osphronemus goramy Lac.
) as experimental animals and samples in this study were performed under the supervision of ethical clearance no.
00007/04/LPPT/
i/2021.
2 Methods 1 Case report An outbreak of giant gourami occurred in earthen ponds in several districts in the Special Region JIPK: Scientific Journal of Fisheries and Marine JIPK Vol 17 No 3.
October 2025 | A Filterable Agent Caused the Hemorrhagic Syndrome on Giant Gourami.
of Yogyakarta.
Indonesia, includes farms in Gamping District.
Sleman Regency, in October 2021.
Moyudan District.
Sleman Regency, in October 2021.
and Wates District.
Kulon Progo Regency, in April 2023 and July 2024.
From 2021 until the last sampling in 2024, this outbreak has recurred every year.
The pattern of this outbreak occurred during the transition from the dry season to the rainy season .
nter seasonal perio.
This outbreak occurred in giant gourami broodstock.
The first report of mortality appeared three days after the onset of clinical symptoms and continued to occur gradually until a total of 15 broodstock died in 10 2 Sample collection Six broodstock giant gourami (Osphronemus goramy Lac.
) weighing approximately 2-2.
5 kg showed clinical symptoms of bleeding and weak swimming on the surface from each location.
They were collected from earthen ponds in Gamping District.
Sleman Regency.
Moyudan District.
Sleman Regency.
and Wates District.
Kulon Progo Regency.
Fish samples were euthanized by immersing in an MS-222 overdose .
mg/mL) according to the American Veterinary Medical Association (AVMA, 2.
Necropsies were performed on antemortem and postmortem examinations.
Liver, kidney, and spleen samples were fixed in 75% ethanol and RNA-Later for molecular analysis and 10% normal buffered formalin for histopathological analysis.
Kidney and spleen tissues were also stored at -80AC for postulate River.
3 Histopathological observation Liver, kidney, and spleen tissues were fixed in 10% NBF for 24 hours.
Fixed tissues were cut into 0.
cm cubes.
The Tissue were proceed using Bioevopeak Automated Tissue Processor by dehydration in graded alcohol and infiltration of paraffin.
The sample was embedded in paraffin and sliced AUAUinto 5 m sections using a manual rotary microtome.
Tissue sections were stained with hematoxylin eosin (Alturkistani et al.
Examination of pathological change was performed under a light microscope.
4 Postulate River Preparation of bacteria-free kidney filtrate followed Murwantoko et al.
The kidneys were homogenized in PBS with a ratio of 1:9 and centrifuged at 3,000 yg for 10 minutes at 4AC.
The supernatant was filtered with a 0.
22-AAm Millipore filter.
The virus filtrate was inoculated into Tryptic Soy Agar (TSA) to ensure it was free from bacteria.
The 30 healthy O.
goramy weighting 150-160 grams .
ength 15 - 18 c.
with active movement and shiny scales were collected from commercial farms that had no history of disease infection, totaling 30 fish for River postulation.
Fish were reared at a density of one fish per one and a half liters of water with a water change every two days with contionuous aeratition at the Laboratory of Fish Health and Environ ment.
Universitas Gadjah Mada.
Fish were acclimatizced for one week and fed commercial feed adlibitum in the morning and evening.
Fish were anesthetized by immersion in 4AC water until movement slowed down (AVMA, 2.
Intraperitoneal injection of 0.
1 mL of bacterial-free filtrate was performed in the infection group and injection of PBS in the control group.
Post-infection, fish were maintained for 14 days with continuous aeration and water changes every two days.
The fish behaviour and mortality were recorded daily.
Liver, kidney, and spleen were collected and preserved in ethanol for further analysis.
DNA and RNA extraction Tissue samples were rinsed with PBS .
H Approximately 10 mg of tissue was homogenized with a micropestle in 300 AAL of PBS and centrifuged at 10,000 yg for 5 min.
DNA was isolated with the Geneaid Viral Nucleic Acid Extraction Kit II following the manufacturerAos protocol.
RNA was isolated using the High Pure RNA separation kit following the manufacturerAos protocol.
The final step of DNA and RNA was eluted in 75 AAL of elution buffer.
The concentration and purity of DNA and RNA were measured using a NanoDrop 2000 spectrophotometer (Garcya-Alegrya et al.
, 2.
Good quality DNA and RNA with absorbance values of AUAU 260/280 in the range of 1.
8Ae2.
0 were stored at Oe80AC until use.
6 PCR and RT-PCR amplification DNA amplification was performed for several possible viruses, including Megalocytivirus.
Viral Haemorrhagic Septicemia Virus (VHSV).
Spring Viraemia Carp Virus (SVCV).
Tilapia Lake Virus (TiLV).
Infectious Haematopoietic Necrosis Virus (IHNV).
Infectious Pancreatic Necrosis Virus (IPNV), and Epizootic Haematopoietic Necrosis Virus (EHNV).
The Primers targeting beta-actin.
EF1 genes were used as housekeeping gene (HKG) for RNA template, and CO1 gene for control marker of DNA template.
Target DNA was amplified using Thermal Cycler TM 100 with primer pairs listed in Table 1.
This addresses the possibility of identifying potential etiologies, especially pathogens that have been reported to infect teleost species.
Several pathogens, such as Megalocytivi Copyright A2025 Faculty of Fisheries and Marine Universitas Airlangga Nikmah et al.
/ JIPK, 17.
:698-708
Table 1.
List of primers targeting suspect viruses and internal controls used in this study Name
MgCyst G1 F
MgCyst G1 R
VN-F
VN-R
Targeted Pair 4R
Pair 4F
IHNV-NF
IHNV-NR
VP2-R
VP2- F
N gene R
N gene F
EF1A F
EF1A R
Actin F
Actin R
COI F
COI R
GCCTGTATATGCATCGT
Megalocytivirus
VHSV
GCACATCGCTGATTGTGT
ATGGAAGGAGGAATTCGTGAAGCG
GCGGTGAAGTGCTGCAGTTc Tm 0C Reference This Study Snow et al.
, 2004
Ip et al.
, 2016
This Study Popova et al.
, 2008
Ballesteros et al.
, 2012
WOAH, 2022
Wang et al.
, 2015
This Study Soliman et al.
, 2017
TCTTGGAGCCaTAGCTCARRTC
SVCV F1
SVCV R2
Sequence SVCV
AGATGGTATGGAcAATACATHACNCAY GcAGAGCCTCTTGTCAAT
TiLV
IHNV
IPNV
GcAGAGCCTCTTGTCAAT
TGAAGTAcAcGAGCAGCATCC
GTTCAACTTCAACGCCAACAGG
CCGCAACTTACTTGAGATCCATTATGC
CGTCTGGTTCAGATTCCACCTGTAGTG
aGAcGtGCAGCaC
EHNV
CGCAGTCAAGGCCTTGATGT
GCACGCTCTGCTGGCCt
EF1A
GCGCTCAATCTTCCATc
CAGCAAGCAGGAGATA
Beta actin
CO1
TGTGTGGTGTGTGGTTGtG TCAACCAACCACaGACATTGGCAC TAGACTTCTgTGGCCaGAATCA rus (Kurita and Nakajima, 2.
VHSV (Dale et al.
SVCV (Souto et al.
, 2.
IHNV (Yong et al.
IPNV (Robles et al.
, 2.
, and EHNV (Becker et al.
, 2.
, have been reported to cause significant morbidity and mortality in farmed and wild fish.
Results and Discussion 1 Results 1 Anatomical pathology Typical clinical symptoms observed in giant gourami samples from Wates District.
Kulon Progo Regency, are bleeding those spreads over the entire body surface (Figure 1A).
Pathological anatomical changes seen include rotted fins (Figure 1A), exophthalmia (Figure 1B), petechiae and pale liver (Figure 1C), visceral adhesion (Figure 1D), and enlarged kidneys (Figure 1E).
2 Postulate River Behavioral changes, clinical symptoms, and mortality occurred in giant gourami after infection.
Fish swam limply on the surface and anorexia was observed three days after injection .
Clinical symptoms of hemorrhage on the body surface (Figure 2A), rotted fins (Figure 2B), and visceral adhesions (Figure 2C) were clearly visible in six dpi.
The control group showed no behavioral changes during the observation Mortality patterns were clearly observed in giant gourami from Wates District.
Kulon Progo Regency fish after infection.
Mortality of the fish was first observed at five dpi at 20% of the population and increased gradually until seven dpi at 25%.
A high increase in mortality was observed at 8 dpi at 60%.
The JIPK: Scientific Journal of Fisheries and Marine JIPK Vol 17 No 3.
October 2025 | A Filterable Agent Caused the Hemorrhagic Syndrome on Giant Gourami.
Figure 1.
Anatomical pathology of sick giant gourami (Osphronemus goramy Lac.
) from Wates District.
(A) Hemorrhagic on the entire body surface and rotted fins, (B) exophthalmia .
hite circl.
, (C) petechiae characterized by black spots on the entire liver surface and the liver color is pale .
ellow circl.
, (D) visceral adhesion with white fascia fibers .
lue arro.
, (E) enlarged kidneys .
hite arro.
Figure 2.
Clinical symptoms of giant gourami (Osphronemus goramy Lac.
) postulate River.
(A) Hemorrhagic on the body surface, (B) rotted fins, and (C) visceral adhesion.
peak of mortality was observed at nine dpi, indicating cumulative mortality of up to 90% of the total population.
The control group did not experience mortality during the observation period (Figure .
Postulate River result using giant gourami samples from Gamping and Moyudan Districts showed the similar clinical signs and mortality patterns with the samples from Wates District.
3 Histopathological observation Histopathological changes were observed in the liver, kidney, spleen, and brain of sick giant gourami from Wates District.
Most of the hepatocyte cells showed lipidosis characterized by spaces in the form of fat droplets in the cytoplasm and pushed the nucleus to the edge of cell.
Liver tissue showed local hemor- Copyright A2025 Faculty of Fisheries and Marine Universitas Airlangga Nikmah et al.
/ JIPK, 17.
:698-708
rhage and sinusoidal enlargement (Figure 4A).
Kidney tissue showed the normal glomeruli, tubules, however the hematopoietic area displayed multiple necrosis, and the intertubular area showed hemorrhage (Figure 4B).
Spleen tissue showed diffuse red and white pulp, hemorrhage, and multiple necrosis (Figure 4C).
Brain tissue showed multiple necrosis, and hemorrhage in gray matter (Figure 4D).
The histopathology of Gamping and Moyudan District samples revealed the similar changes as in Wates District samples.
The liver, kidney, spleen, and brain all showed histopathological changes in River postulate giant Liver tissue was observed with hepatocyte cells that were mostly lipidosis with fat droplets in the Hemorrhage with sinusoid enlargement and multiple necrosis were also observed in liver tissue (Figure 5A).
Kidney tissue showed hemorrhage and melanomacrophage center .
in the intertubular (Figure 5B).
Spleen tissue showed hemorrhage and multiple necrosis (Figure 5C).
Brain tissue showed hemorrhage in the white matter (Figure 5D).
Figure 3.
Cumulative mortality (%) of giant gourami (Osphronemus goramy Lac.
Fish were injected intraperitoneally with kidney homogenate, and control fish were injected with sterile PBS.
Figure 4.
Histopathology of diseased giant gourami (Osphronemus goramy Lac.
) from Wates District.
(A) liver shows lipidosis .
hite arro.
, congestion .
ed arro.
, and local hemorrhage .
ed circl.
(B) kidney shows hemorrhage .
ed arro.
and multiple necrosis .
hite circl.
(C) spleen shows hemorrhage .
ed arro.
and multiple necrosis .
hite circl.
(D)
brain shows hemorrhage .
ed arro.
and multiple necrosis .
hite circl.
JIPK: Scientific Journal of Fisheries and Marine JIPK Vol 17 No 3.
October 2025 | A Filterable Agent Caused the Hemorrhagic Syndrome on Giant Gourami.
Figure 5.
Histopathology of postulate River giant gourami (Osphronemus goramy Lac.
) tissue.
(A) liver shows lipidosis .
hite arro.
and congestion .
ed arro.
(B) kidney shows hemorrhage .
ed arro.
and mmc .
hite circl.
(C) spleen shows hemorrhage .
ed arro.
and multiple necrosis .
hite circl.
(D) brain shows hemorrhage .
ed 4 PCR and RT-PCR Molecular detection using PCR and RT-PCR was carried out to identify viruses as etiological agents of disease outbreaks in giant gourami.
Molecular detection results were negative for Megalocytivirus.
VHSV.
SVCV.
TiLV.
IHNV.
IPNV, and EHNV The house keeping genes as beta-actin and EF1, also control marker of CO1 were amplified in all RNA and DNA samples, respectively.
2 Discussion 1 Anatomical pathology Every year, seasonal disease outbreaks affect giant gourami (Osphronemus goramy Lac.
), an important freshwater fish commodity in Indonesia.
Yogyakarta reports the outbreak in Gamping District.
Sleman Regency.
Moyudan District.
Sleman Regency.
and Wates District.
Kulon Progo Regency.
The most reported typical clinical symptoms include hemorrhagic (Figure 1A), rotted fins (Figure 1A), and visceral adhesions (Figure 1D).
Hemorrhagic clinical symptoms refer to bleeding conditions that can occur in various tissues and or Various types of pathogens, including viruses, can cause this pathogenic condition (Ahmadivand et , 2.
Visceral adhesions are pathological conditions in which internal organs stick together in the body cavity due to the formation of fibrous tissue (Deynez et al.
, 2.
This condition has been reported to occur in response to parasitic infection (Nagasawa et al.
, injury (Liakakos et al.
, 2.
, ischemia (Liakakos et al.
, 2.
, and chronic inflammation (Deynez et al.
, 2.
The anatomical pathology of sick fish also shows exophthalmia (Figure 1B), petechiae and pale liver color (Figure 1C), and kidney enlargement (Figure 1E).
Exophthalmia is abnormally protruding eyes caused by various infectious and non-infectious factors (Noor El Deen et al.
, 2.
Viral infection is one of the causes of exophthalmia, as reported due to VHSV infection (Ahmadivand et al.
, 2.
and SVCV (Ashraf et al.
, 2.
Petechiae are purplish-red spots caused by bleeding.
pathogen infection is one of the causes (Ahmadivand et al.
, 2.
Researchers have reported that VHSV infection (Ahmadivand et al.
and TiLV (Pierezan et al.
, 2.
cause pale liver and petechiae.
Pale liver and enlargement of kidney were reported on the ISKNV infection (Murwantoko Copyright A2025 Faculty of Fisheries and Marine Universitas Airlangga Nikmah et al.
/ JIPK, 17.
:698-708
et al.
, 2.
Kidney enlargement in fish has been previously reported to be caused by pathogen infection (Bunnajirakul et al.
, 2015.
Gorgoglione et al.
, 2.
and environmental stress (Mishra and Mohanty, 2.
These clinical symptoms have been reported in megalocytivirus infections, including hemorrhage on the skin and fins, rotted fins, pale body color, decreased swimming activity, enlarged abdomen, and visceral adhesions due to chronic inflammation (Kurita and Nakajima, 2012.
Subramaniam et al.
, 2.
The histopathological analysis of the kidney, liver, and spleen organs of the fish carried out by the postulate River.
2 Mortality Rivers .
proposed his postulate to establish a causal relationship between virus and disease, , that specific virus should be associated with disease, it should present occurrence in sick individuals as a cause of the disease under investigation instead of a coincidence or accidental finding, and a virus acquired from a sick individual can cause the same disease and symptoms when administered to a healthy Bacterial-free tissue homogenate infection caused the mortality of giant gourami.
The first mortality of fish in this study occurred at five dpi, with peak mortality observed at eight dpi (Figure .
The mortality pattern in the postulate River shows a clear trend, increasing slowly and reaching a total of 90% by nine dpi, indicating that the disease incubation is between five and nine days after infection.
Mortality due to virus infection shows a predictable pattern.
The mortality pattern of fish after infection is related to the incubation of the virus, which depends on the type of virus, immune system, and environmental conditions (Ludwig et al.
, 2.
3 Histopathological alterations Bacterial-free tissue homogenate infection caused clinical symptoms of external hemorrhage on the superficial body, rotted fins, and visceral adhesions (Figure .
Histopathology observation of infected fishes demonstrated the congestion and hemorrhagic in the kidney, liver, and spleen and fatty degeneration in the hepatic organs.
Those result shows the similarity with the histopathological change on outbreak sick giant gourami.
Based on those above results of Postulat RiverAos experiment on the mortality, clinical symptoms and anatomical pathology gave similar signs from outbreak diseased fish supported the conclusion on the fulfills the requirements of RiverAos proposition.
The disease outbreak attacking giant gourami at Yogyakarta was caused by filterable agent or may a virus.
Hemorrhage in surface and internal organs were important sign in this disease case (Figure 1, .
The hemorrhage of fish has been reported in the infection by several viruses, including ISKNV (Nguyen et , 2.
VHSV (Dale et al.
, 2.
Megalocytivirus (Kurita and Nakajima, 2.
Iridovirus (Qin et al.
SVCV (Souto et al.
, 2.
TiLV (Tattiyapong et al.
, 2.
IHNV (Yong et al.
, 2.
IPNV (Robles et al.
, 2.
, and EHNV (Becker et al.
, 2.
Molecular detection Molecular detection using PCR and RT-PCR was carried out to identify the virus might causing disease in the giant gourami disease outbreak.
The electrophoresis results showed that no target genes were amplified, so they were negative for several possible diseases caused by Megalocytivirus.
VHSV.
SVCV.
TiLV.
IHNV.
IPNV, and EHNV.
The expression of housekeeping genes and control marker needs to be known to ensure the quality of the template (Wang et , 2.
EF1 and beta-actin are one of the optimal housekeeping genes in fish for precise and accurate gene expression analysis during pathogen infection (Wang et al.
, 2.
CO1 is important as a control marker of DNA templates (Asgharian et al.
, 2.
this study.
PCR and RT-PCR tests successfully amplified control marker and all housekeeping genes, including COI, beta-actin, and EF1, indicating that the DNA and RNA samples were in good condition.
Conclusion The outbreak disease on giant gourami (Osphronemus goramy Lac.
) at Yogyakarta gave pathognomonic symptoms of hemorrhagic in the superficial body and in several internal organs designed as Hemorrhagic Syndrome.
The same pathological changes of artificial infected fish with outbreak sick fish supported the conclusion on the fulfills the of Postulate RiversAo proposition, and the Hemorrhagic Syndrome was caused by filterable agent or may a virus.
It is plausible that a novel, unidentified viral strain to cause this disease.
Multiple indicators of diagnosis for etiological agents, such as behavioral anomalies, clinical signs, histopathological changes, incubation period, and mortality patterns, indicate the existence of a pathogen as the etiological agent.
Nevertheless, molecular testing has not yet detected the pathogen.
Consequently, a thorough, interdisciplinary investigation strategy is required to ascertain the explanation of this phenomenon.
Acknowledgement This research was supported by fish farmers JIPK: Scientific Journal of Fisheries and Marine JIPK Vol 17 No 3.
October 2025 | A Filterable Agent Caused the Hemorrhagic Syndrome on Giant Gourami.
from Gamping and Moyudan Districts.
Sleman Regency, and Wates District.
Kulon Progo Regency, in providing samples of sick fish and assisting with technical sampling in ponds.
Thank to Ms.
Lintang Aprilia Hapsari for supporting on the laboratory activities.
AuthorsAo Contributions NLFN: provided the main conceptual ideas, developed the methods, conducted laboratory and field experiments, handled the experimental animal, analyzed the data, designed the figures, and improved the manuscript.
Mw: developed methods, analyzed the data, earned funds for the laboratory and field activities, and finalized the manuscript.
All authors discussed the results and contributed to the final manuscript.
Conflict of Interest The authors declare no competing interest.
Declaration of Artificial Intelligence (AI) This entire research does not use artificial intelligence (AI) tools, services, or technologies in the creation, editing, or refinement of this manuscript.
All content presented is the result of independent intellectual efforts that guarantee originality and integrity.
Funding Information This work was supported by a grant from The Ministry of Education Culture and Research of Republic of Indonesia on AuProgram Magister menuju Doktor untuk Sarjana Unggul (PMDSU).
Molecular Characterization of Emergence Fish Virus in Aquaculture.
No.
B/277/D3.
2/KD.
00/2019Ay.
References