Jurnal Akuakultur Indonesia 24 .
, 1Ae9 .
DOI: 10.
19027/jai.
Original article SNP2-Lys-C markers inheritance, genes expression, and the resistance of second-generation Catfish Clarias gariepinus against Aeromonas hydrophila Pewarisan marka SNP2- LYS-C, ekspresi gen, dan daya tahan ikan lele Clarias gariepinus generasi kedua terhadap infeksi Aeromonas hydrophila Yudha Hanggara.
Alimuddin Alimuddin*.
Dinar Tri Soelistyowati.
Sri Nuryati Department of Aquaculture.
Faculty of Fisheries and Marine Science.
IPB University.
Bogor.
West Java 16680.
Indonesia *Corresponding author: alimuddin@apps.
(Received December 8, 2023.
Revised April 22, 2024.
Accepted August 9, 2.
ABSTRACT High mortality rates in catfish seed caused by motile aeromonas septicemia disease caused by Aeromonas hydrophila The primary focus is on the genetic selection of the second generation (G.
catfish for resistance to A.
hydrophila, utilizing the type-C lysozyme gene at SNP-2 genotype TT.
The objective is to assess the inheritance of the SNP2-Lys-C genetic marker from the first generation (G.
Sangkuriang broods and to evaluate the resistance of the G2 seed to infection.
In the experiment.
G1 broods with the TT genotype were spawned, and the resulting G2 seed were challenged with A.
The findings indicate that all G2 seed possess the TT genotype and exhibit a higher survival rate compared to the dominant CT genotype seed.
The expression of the Lys-C gene in G2 seed is elevated at the onset of infection, decreasing after the seventh day.
The expression of the MHC1a and IL-1b genes is also associated with a higher survival rate.
The survival of G2 seed correlates with the white blood cell and lysozyme activity, along with an increase in phagocytic activity peaking on the seventh day post-challenge.
The conclusion of this study suggests that G2 catfish seed with the TT genotype have stronger resistance to A.
hydrophila infection compared to seed with the dominant CT genotype.
Keywords: Aeromonas hydrophila, catfish, genotype, lysozyme, resistance ABSTRAK Mortalitas tinggi yang terjadi pada benih lele yang disebabkan oleh penyakit motile aeromonas septicemia akibat Aeromonas hydrophila.
Fokus utama adalah pada seleksi genetik generasi kedua (G.
lele untuk resistensi terhadap hydrophila, menggunakan gen lisozim tipe-C pada SNP-2 genotipe TT.
Studi ini bertujuan menilai pewarisan marka genetik SNP2-Lys-C dari induk sangkuriang generasi pertama (G.
dan mengevaluasi ketahanan benih G2 terhadap infeksi.
Dalam eksperimen, induk G1 genotipe TT dipijahkan dan benih G2 yang dihasilkan diuji dengan bakteri A.
Hasil menunjukkan bahwa semua benih G2 memiliki genotipe TT dan menunjukkan tingkat kelangsungan hidup yang lebih baik dibandingkan dengan benih dominan genotipe CT.
Ekspresi gen Lys-C pada benih G2 tinggi pada awal infeksi, menurun setelah hari ketujuh.
Ekspresi gen MHC1a dan IL-1b juga terkait dengan tingkat kelangsungan hidup yang lebih tinggi.
Kelangsungan hidup benih G2 berkorelasi dengan jumlah sel darah putih dan aktivitas lisozim, serta peningkatan aktivitas fagositik yang mencapai puncak pada hari ketujuh.
Kesimpulan studi ini menunjukkan bahwa benih lele G2 dengan genotipe TT memiliki resistensi yang lebih kuat terhadap infeksi A.
hydrophila dibandingkan dengan benih dominan genotipe CT.
Kata kunci: Aeromonas hydrophila, genotipe, ikan lele, lisozim, resistan Yudha Hanggara et al.
/ Jurnal Akuakultur Indonesia 24 .
, 1Ae9 .
INTRODUCTION The production of catfish (Clarias gariepinu.
in Indonesia has been increasing from 2017 to 2021, with an average growth rate of 10.
(DJPB, 2.
The catfish strains cultivated in Indonesia include Sangkuriang catfish.
Dumbo catfish.
Phyton catfish, and Pearl catfish.
Intensified catfish farming has led to a decline in water quality and a higher chance of infection by disease-causing organisms that can result in the death of catfish fry.
One example is the bacterium Aeromonas, which causes motile aeromonas septicemia (MAS) (Zhang et al.
, 2016.
Oladele et al.
, 2021.
Sumitro et al.
, 2021.
Russell et al.
According to Bakiyev et al.
, the bacterium Aeromonas hydrophila can cause up to 100% mortality in catfish farms.
MAS infections also result in mass deaths ranging from 87-100% in carp (Khumaidi & Hidayat, 2.
Efforts have been made to reduce the impact of A.
hydrophila infections using immunostimulants (Astria et al.
, 2017.
Abdallah et al.
, 2.
, vaccines (Mulia et al.
, 2015.
Taukhid et al.
, 2.
, and bacteriophages (Choudhury et al.
, 2017.
Le et al.
, 2.
Additionally, to lessen the impact of A.
hydrophila infections and environmental stress, it is necessary to use seeds that are resistant to disease infections (Nasrullah et al.
, 2.
Disease-resistant seeds can be obtained through either conventional or molecular selection (Das & Sahoo, 2.
Conventional selection methods are time-consuming and require many fish, whereas molecular selection is faster and more effective.
Molecular selection is a method used to select fish based on their genetic information.
In fish, molecular selection can utilize single nucleotide polymorphisms (SNP.
SNPs are single nucleotide variations in DNA that can be used to identify genetic differences between individuals related to specific traits.
SNP-based selection methods are often used to select fish with specific traits, such as disease resistance (Liu et al.
or fast growth (Zhou et al.
, 2022.
Chen et al.
, 2.
SNP marker selection has already been applied to Litopenaeus vannamei shrimp for ammonia tolerance.
The study found that 12 out of 49 SNPs were strongly associated with ammonia tolerance, as evidenced by significant differences in 10 loci with different alleles and genotypes between ammonia-tolerant (AT) and ammonia-sensitive (AS) groups (Lu et al.
, 2.
Selection of catfish using SNP markers for resistance to A.
hydrophila infection has been conducted by Nasrullah et al.
, which showed that the lysozyme type-C gene can differentiate between catfish that are resistant and susceptible to A.
hydrophila infection.
The difference between resistant and susceptible catfish lies in the genotype of SNP variant 2.
The TT genotype .
hymine thymin.
represents catfish that are resistant to A.
hydrophila infection, while the CC genotype .
ytosine cytosin.
represents catfish that are susceptible, and the CT genotype .
ytosine thymin.
is intermediate between resistant and susceptible.
Applying SNP-based selection for lysozyme type-C gene at SNP 2 with TT genotype needs to be evaluated across generations to assess the consistency of resistance levels to A.
hydrophila infection and the inheritance pattern of resistance genes in their MATERIALS AND METHODS Preparation of test material Catfish seeds were obtained from the spawning of selected catfish with the TT genotype from the first generation (G.
, with four pairs, and from the spawning of Sangkuriang catfish without selection from the Sukabumi Freshwater Aquaculture Center and local catfish farmers in Bogor (Table .
The resulting seeds were raised until they reached a size of 8-9 cm for testing their resistance to A.
hydrophila infection.
Table 1.
Spawning scheme of selected TT genotype catfish (G.
and non-selected Sangkuriang Catfish.
Treatment Genotype oA TT y oC TT (Selected Sangkuriang G.
oA Sangkuriang y oC Sangkuriang (Non-selecte.
SNP marker-based genotype selection Potential broodstock with the TT genotype (G.
was selected using the polymerase chain reaction (PCR) method.
Genotyping analysis began with DNA extraction.
The DNA extraction procedure involved taking tail fin samples from the catfish, which were then extracted using the Genomic DNA Mini Kit (Geneaid.
USA).
PCR
amplification was performed using primers based on Nasrullah et al.
PCR products were visualized using electrophoresis on a 1% agarose Four pairs of confirmed TT genotype parents Yudha Hanggara et al.
/ Jurnal Akuakultur Indonesia 24 .
, 1Ae9 .
were then used for spawning to produce secondgeneration (G.
Subsequently, the catfish seeds from the spawning of selected oA TT y oC TT parents and non-selected oA Sangkuriang y oC Sangkuriang
SNP2
marker-based genotyping analysis.
A total of 10 fish from each spawning batch were analyzed.
Resistance testing to A.
Resistance testing to A.
hydrophila was conducted by intramuscularly injecting the bacteria at an LD50 dose of 0.
1y107 CFU/mL per Test fish, measuring 8-9 cm, were used in groups of 30 per treatment with four replicates.
The fish were then maintained for 15 days, and mortality was observed.
Red and white blood cell parameters were analyzed periodically on days 0, 3, 7, and 15.
Phagocytic activity Post-injection phagocytic activity of A.
hydrophila was measured on days 0, 3, 7, and 15, according to Anderson and Siwicki .
A 50 AAL blood sample was added to a microtube and mixed with 50 AAL of Staphylococcus aureus .
ensity 107 CFU/mL) diluted with PBS, then The blood-bacteria solution was incubated at 28AC for 20 minutes.
Then, 5 AAL of the solution was placed on a glass slide to prepare a smear.
The smear was fixed in methanol for 10 minutes and air-dried, then stained with 10% Giemsa for 10 minutes and air-dried.
After rinsing with running water, the smear was observed under a microscope.
Phagocytic activity was calculated based on the percentage of 100 cells showing phagocytic activity using the following formula:
Red blood cells Red and white blood cell analysis was performed before and after bacterial injections on days 0, 3, 7, and 15.
Blood collection was preceded by anesthesia with clove oil .
mL/L).
Blood was drawn using a 1 mL syringe pre-rinsed with an anticoagulant from the base of the tail.
The method for blood cell testing followed Hesser .
Fish blood samples were aspirated with a Sahli pipette to the 0.
5 scale, then diluted with Hayem solution to the maximum scale of 101.
The solution was homogenized by gently shaking the pipette in a figure-eight motion for one to two minutes.
Two drops of the blood solution were discarded, and the remaining blood was placed on a hemocytometer with a coverslip.
Observations were made using a microscope at 400y magnification.
Lysozyme activity Serum was collected from blood samples without anticoagulant.
The samples were left at room temperature for two hours, then stored in a refrigerator at 4AC for a full day.
Serum was then centrifuged at 5,000 rpm for three minutes to obtain serum.
The lysozyme activity was measured according to Hanif et al.
A 100 AAL sample was mixed with 0.
2 mg/mL Micrococcus luteus suspension in PBS .
H Absorbance was measured twice using a microplate reader at 450 nm after 30 seconds of mixing and repeated after 30 minutes.
The lysozyme activity unit was determined based on the enzymeAos capacity to reduce absorbance 001 per minute.
Lysozyme activity was calculated using the following formula:
White blood cells White blood cells in the A.
hydrophila test treatments were measured on days 0, 3, 7, and The white blood cell measurement method followed Hesser .
Fish blood samples were taken using a white cell pipette to the 0.
5 scale.
The pipette tip was cleaned with tissue, then the sample was mixed with TurkAos solution to the 11 The mixture was homogenized by gently shaking the pipette in a figure-eight motion for one to two minutes.
Two drops of the blood solution were discarded, and the remaining blood was placed on a hemocytometer with a coverslip.
Observations were made using a microscope at 400y magnification.
Gene expression analysis Total RNA was extracted using GENEzol reagent (Geneaid.
Taiwa.
according to the manufacturerAos manual.
RNA concentration and purity were measured using a spectrophotometer on a Pharmacia Genequant RNA/DNA Calculator (Pharmacia Biotech.
UK).
cDNA synthesis was performed from the total RNA extract with a concentration of 50 ng/AAL using ReverTraAce qPCR RT Master Mix with gDNA Remover (Toyobo.
Japa.
, following the manufacturerAos The obtained cDNA solution was Yudha Hanggara et al.
/ Jurnal Akuakultur Indonesia 24 .
, 1Ae9 .
diluted 10 times with NFW and stored at -20AC until analysis.
Genes analyzed included -actin.
Lysozyme type-C.
Interleukin-1, and MHC-1.
cDNA amplification was performed with a final PCR reaction volume of 20 AAL consisting of 10 AAL SensiFAST SYBR NO-ROX (Bioline.
UK).
4 AAL
cDNA .
ng/AAL).
8 AAL of each primer .
AAM).
4 AAL NFW.
qPCR analysis was conducted on a Linegene K Plus machine (Bioer.
Chin.
The primer sequences used are shown in Table 3.
Gene expression levels were analyzed after normalizing each gene expression to -actin expression.
Gene expression levels were calculated using the 2-iict method (Schmittgen & Livak, 2.
Data analysis Data were analyzed using Microsoft Excel 365 and IBM SPSS 26 software for analysis of variance (ANOVA) with a 95% confidence interval, followed by DuncanAos multiple range RESULTS AND DISCUSSION Result Gene inheritance The G2 catfish seeds resulting from the TTyTT spawning showed 100% TT genotype.
The spawning of Sangkuriang catfish from local farmers in Bogor (PT) produced seeds with 60% TT genotype and 40% CT genotype.
Meanwhile, the spawning of Sangkuriang catfish from the Sukabumi Freshwater Aquaculture Center (SB) produced seeds with 40% TT genotype and 60% CT genotype.
A total of 10 seeds from each treatment were examined.
Survival rate The highest survival rate of catfish seeds at the end of the post-challenge period with A.
hydrophila was observed in the TTA spawning, and it was not significantly different from PT (Figure .
The lowest survival rate was observed in SB, which was 51.
Red blood cells The total red blood cell counts in seeds from TT genotype parents tended to be more stable after the challenge test.
The total red blood cells in seeds from Sangkuriang parents (PT and SB) increased on day 3 post-challenge.
The total red blood cell counts in the TTA.
TTB, and PT treatments were significantly higher before the challenge test .
<0.
Figure .
compared to SB.
White blood cells The total white blood cell count increased in all treatments on day three (H.
and began to decrease on day 14 (H.
Treatments TTA and PT had the highest white blood cell counts on day 0 (H.
or before the challenge .
<0.
compared to TTB and SB (Figure .
The highest white blood cell count was observed on day seven.
Phagocytic activity Phagocytic activity (PA) increased and was higher on day seven (H.
compared to before the challenge (H.
in all treatments: TTA.
TTB.
PT, and SB (Figure .
Subsequently, the PA on day Table 2.
Primer sequences used for real-time PCR.
Gene Forward Primer Sequence .
Ao Ae 3A.
Reverse Primer Sequence .
Ao Ae 3A.
-aktin
ACCGGAGTCCATCACAATACCAGT
GAGCTGCGTGTTGcTGAG
Lisozim type-C
AAGGTATGATCGGTGTGAGCTGG
CGGTTCTgCGTTGGTATTGA
Interleukin1
GCAGTGCACCAtGCGATA
gTTATACGCGCTCAGGTT
MHC-1
AGACTCTGACCTGGATCGCT
CCAGTCGATACACTCCTTCTCC
Table 3.
Results of marker inheritance in catfish seeds.
Treatment Genotype (%) TT y TT (TTA) TT y TT (TTB) Non Selected Farmer (PT) Non Selected (SB) Note: TTA = Spawning result of TT y TT pair A.
TTB = Spawning result of TT y TT pair B.
Yudha Hanggara et al.
/ Jurnal Akuakultur Indonesia 24 .
, 1Ae9 .
Figure 1.
Survival rate of G2 catfish seeds challenged with Aeromonas hydrophila bacteria.
Different letters above the bar chart indicate significant differences (DuncanAos test: p<0.
Figure 2.
Total red blood cells of G2 catfish challenged with A.
Different letters above the bar chart indicate significant differences (DuncanAos test: p<0.
H0.
H3.
H7, and H14 represent the total red blood cells after challenging them with A.
Figure 3.
Total white blood cells of G2 catfish challenged with A.
Different letters above the bar chart on the same day indicate significant differences (DuncanAos test: p<0.
H0.
H3.
H7, and H14 represent the total white blood cells after challenging with A.
Figure 4.
Phagocytic activity of G2 catfish challenged with A.
Different letters above the bar chart indicate significant differences (DuncanAos test: p<0.
H0.
H3.
H7, and H14 represent phagocytic activity after challenging with A.
Yudha Hanggara et al.
/ Jurnal Akuakultur Indonesia 24 .
, 1Ae9 .
14 (H.
decreased and returned to levels like those on day 0 (H.
In G2 seeds.
PA values for treatments TTA and TTB were higher than for SB .
<0.
Lysozyme activity Lysozyme activity exhibited varying patterns across treatments.
The highest lysozyme activity was observed in treatment TTB on day 0 (H.
(Figure .
The lowest lysozyme activity was recorded across all treatments on day 7 (H.
, with levels increasing again on day 14 (H.
Gene expression Expression of the Lys-C gene (Figure 6A) was high on days 1 and 3, and then decreased on days 7 and 14 post-infection.
The expression patterns of the IL-1b gene (Figure 6B) and MHC1a gene (Figure 6C) varied among different crosses, but generally, the expression levels were higher on day 1 for catfish with higher survival rates.
Figure 5.
Lysozyme activity of G2 catfish challenged with A.
Different letters above the bar chart indicate significant differences (DuncanAos test: p<0.
H0.
H3.
H7, and H14 represent lysozyme activity after challenging with A.
(A)
(B)
(C)
Figure 6.
Gene expression of lysozyme-C (A), interleukin-1b (B), and MHC-1a (C) in G2 catfish challenged with Different letters above the bar charts indicate significant differences (DuncanAos test: p<0.
H0,
H3.
H7, and H14 represent relative gene expression levels after challenging with A.
Yudha Hanggara et al.
/ Jurnal Akuakultur Indonesia 24 .
, 1Ae9 .
Discussion The inheritance of genotype markers in treatments TTA and TTB showed that 100% of the resulting seeds had the TT genotype.
This result is consistent with MendelAos law, which states that crossing two homozygous individuals will produce 100% homozygous offspring.
The highest survival rate was observed in treatment TTA with a survival rate of 91.
67%, while the lowest was from the SB treatment with a survival rate of 51.
Seeds with the dominant TT genotype tend to have a higher survival rate.
The total red blood cell counts in treatments TTA and TTB was relatively stable compared to treatments PT and SB.
An increase in red blood cells was noted due to an infection with According to Yu et al.
, an increase in red blood cells can assist in immune responses by recognizing antigens.
The total white blood cell count on day 0 in the treatment with the highest survival rate was higher than in other treatments.
Overall, white blood cell counts increased on days three and seven after challenge testing, indicating that white blood cells play a role in the immune system.
The increase in white blood cells occurs as an effort to defend the body against pathogen attacks (Shen et al.
, 2.
The highest phagocytic activity was observed on day 7, which corresponds with the peak in white blood cell counts.
This increase in phagocytic activity indicates the process of destroying foreign particles or disease-causing bacteria by macrophages (Nainggolan et al.
The expression patterns of the lysozyme-C.
MHC-1a, and IL-1b genes in seeds with high survival rates showed high gene expression at the early stages of the challenge test.
Lysozyme-C is an enzyme that functions as part of the nonspecific immune system (Mai et , 2.
Interleukins are a group of cytokines that play a role in immune responses (Elmowalid et al.
, 2.
MHC-1a functions as a gene presenting cells to cytotoxic T-cells (Yamaguchi & Dijkstra, 2.
Based on the results, seeds with high survival rates exhibited a strong immune response at the early stages of the challenge with Aeromonas hydrophila.
CONCLUSION
Crossbreeding of TT genotype catfish (G.
with SNP2-Lys-C marker-based selection resulted in a second generation (G.
with resistance to A.
hydrophila infection (TT), achieving a survival rate of 72-92%.
ACKNOWLEDGMENT
We thank the Ministry of Education.
Culture.
Research, and Technology of the Republic of Indonesia for funding through the masterAos grant scheme under contract number 102/ES/PG.
PL/2023.
REFERENCES