Int. Journal of Renewable Energy Development 7 (2) 2018: 101-109

P a g e | 101

Contents list available at IJRED website

Int. Journal of Renewable Energy Development (IJRED)
Journal homepage: http://ejournal.undip.ac.id/index.php/ijred
Research Article

Effect of Different Inoculum Combination on Biohydrogen
Production from Melon Fruit Waste
Yumechris Amekana, Dyah Sekar Ayu Pudak Wangia, Muhammad Nur Cahyantob, Sartoc,*
and Jaka Widadad
a
b

Department of Biotechnology, Gadjah Mada University, Yogyakarta, Indonesia, 55281

Department of Food and Agricultural Product Technology, Faculty of Agricultural Technology, Gadjah Mada University, Yogyakarta,
Indonesia, 55281
*c
d

Department of Chemical Engineering, Gadjah Mada University, Yogyakarta, Indonesia, 55281

Department Agriculture Microbiology, Gadjah Mada University, Yogyakarta, Indonesia, 55281

ABSTRACT. The natural microbial consortium from many sources widely used for hydrogen production. Type of substrate and operating
conditions applied on the biodigesters of the natural consortium used as inoculum impact the variation of species and number of microbes
that induce biogas formation, so this study examined the effect of different inoculum source and its combination of biohydrogen production
performance. The hydrogen producing bacteria from fruit waste digester (FW), cow dung digester (CD), and tofu waste digester (TW)
enriched under strictly anaerobic conditions at 37OC. Inoculums from 3 different digesters (FW, CD, and TW) and its combination (FW-CD,
CD-TW, FW-TW, and FW-CD-TW) were used to test the hydrogen production from melon waste with volatile solids (VS) concentration of
9.65 g/L, 37°C and initial pH 7.05 ± 0.05. The results showed that individual and combined inoculum produced the gas comprising hydrogen
and carbon dioxide without any detectable methane. The highest cumulative hydrogen production of 743 mL (yield 207.56 mL/gVS) and
1,132 mL (yield 231.02 mL/gVS) was shown by FW and FW-CD-TW, respectively. Butyric, acetate, formic and propionic were the primary
soluble metabolites produced by all the cultures, and the result proves that higher production of propionic acid can decrease hydrogen yield.
Clostridium perfringens and Clostridium baratii prominently seen in all single and combination inoculum. Experimental evidence suggests
that the inoculum from different biodigesters able to adapt well to the environmental conditions and the new substrate after a combination
process as a result of metabolic flexibility derived from the microbial diversity in the community to produce hydrogen. Therefore, inoculum
combination could be used as a strategy to improve systems for on-farm energy recovery from animal and plant waste to processing of food
and municipal waste.
Keywords: Inoculum; Biohydrogen; Melon fruit waste; Dark Fermentation; Denaturing Gradient Gel Electrophoresis
Article History: Received February 5th 2018; Received in revised form May 7th 2018; Accepted June 2nd 2018; Available online
How to Cite This Article: Amekan, Y., Wangi, D.S.A.P., Cahyanto, M.N., Sarto and Widada, J. (2018) Effect of Different Inoculum Combination
on Biohydrogen Production from Melon Fruit Waste. Int. Journal of Renewable Energy Development, 7(2), 101-109.
https://doi.org/10.14710/ijred.7.2.101-109

1. Introduction
Currently, the high rate of economic and population
growth led to an increase in fuel demand as the main
energy source for industry, transportation, and even
electricity generation. Concern about rapid depletion of
fossil fuels and environmental pollution are stimulating
studies on alternative energy sources to reduce
dependence on fossil fuels (Das and Veziroglu, 2001).
Hydrogen (H2) is a potential energy carrier because it is
renewable
(Karthic
and
Joseph,
2012),
clean
(Sivagurunathan et al., 2016) and has a very high energy
yield (122 kJ/g). It is 2.75 times greater than fossil fuels
(Hand and Shin, 2004; Kapdan and Kargi, 2006; Choi and
Ahn, 2015). Hydrogen can be produced biologically and
chemically (Sivagurunathan et al., 2016; Hand and Shin,
*

2004; Kumar et al., 2015). Biological hydrogen production
through photosynthesis and fermentation are more
environmentally friendly with lower energy requirements
than chemical production processes (Kumar et al., 2015;
Pachapur et al., 2015). Anaerobic fermentation is simpler
because
the
process
does
not
require
light
(Sivagurunathan et al., 2016; Hand and Shin, 2004) and it
can apply to wide range of feedstocks (Nath and Das,
2004). Current research has studied various types of
substrates for hydrogen production, such as glucose (Li et
al., 2008), sucrose (Choi and Ahn, 2015), galactose
(Sivagurunathan et al., 2016), cassava starch (Tien et al,
2016), the starch residue of sweet potato (Yokoi et al.,
2001), sugarcane bagasse (Pattra et al., 2008) and extracts
of pineapple wastes (Ruknongsaeng et al., 2005). The

Corresponding author: sarto@chemeng.ugm.ac.id

© IJRED – ISSN: 2252-4940, July 15th 2018, All rights reserved

Citation: Amekan, Y., Wangi, D.S.A.P., Cahyanto, M.N., Sarto and Widada, J..(2018), Effect of Different Inoculum Combination on Biohydrogen Production from Melon
Fruit Waste. Int. Journal of Renewable Energy Development, 7(2), 101-109, doi.org/10.14710/ijred.7.2.101-109

P a g e | 102
availability,
cost,
carbohydrate
content
and
biodegradability are the important criteria for the
substrate selection (Kapdan and Kargi, 2006; Cai, et al.,
2009). In Indonesia, melon production reached 129,706
tons/year with the potential for waste generated ±12,970
tons/year. Melon waste containing lignin (8.26%),
hemicellulose (22.71%), cellulose (19.01%), soluble starch
(17.22%), total sugar (30.42%), lipid (6.91%), total N
(0.89%), total solids (7.67%) and volatile solids (6.45%).
Cahyari et al. (2011) using melon fruit waste as a
substrate for hydrogen production in batch at
thermophilic conditions (55°C) yield 5.96 mmole H2/gVS,
and the potential H2 production reached 185,808,197 m3
STP.
According to Reith et al. (2003), the formation of biogas
(anaerobic digestion) induced by various types of microbes,
usually obtained through a natural enrichment of each
substrate used. The composition and amount of bacteria
involved in this process will vary depending on the type of
substrate and fermentation conditions were applied,
causing the variation of yield and biogas production rate
(Sivagurunathan et al., 2016; Pachapur et al., 2015; Insam
et al., 2010). Sivagurunathan et al. (2014) conducted a
study on the use of a combination of three different mixed
cultures (cow dung, pig slurry, and sewage sludge) to
increase hydrogen production using glucose as a
substrate. The results showed an increase in hydrogen
yield and production rate by mixed cultures of pig
slurry+sewage sludge (2.34mole H2/mole glucose and 6.76
L/day) compared to the single culture of pig slurry (1.59
mole H2/mole glucose and 4.43 L/day). An understanding
of the effect of an increase in the interaction between
microbial diversity and the production of hydrogen is
essential to form a stable hydrogen production process.
Therefore, in the present study, we investigated the effect
of inoculum from different biogas digesters (tofu waste,
fruit waste and cow dung anaerobic digester) and their
combinations to the biohydrogen production performance
and soluble metabolites production using melon fruit
waste as the substrate in the batch test.

2.2 Enrichment of hydrogen-producing bacteria

2. Materials and Methods

2.4 Analytical methods

2.1 Inoculum and substrate preparation

The volume of biogas was measured using an airtight
glass syringe. The biogas composition (H2, CH4, and CO2)
analysed with a gas chromatograph having a thermal
conductivity detector (GC-14B, Shimadzu, Japan). The
analytical procedures of standard methods (APHA, 1998)
were used to determine the pH, and VS. Volatile fatty
acids (VFA) were analysed using gas chromatograph
having a flame ionisation detector (Hewlett Packard 5890
Series II).

The seed sludge collected from fruit waste, cow dung
and tofu waste biodigester in Yogyakarta (Indonesia),
designated as FW, CD, and TW, respectively, for enriching
the mixed cultures. All microbial sources were acidified to
pH 3 through the addition of 2 M HCl and maintaining for
24 hours, then adjusting back to pH 6.8 with the addition
of 2 M NaOH (Ren et al., 2008) to deactivate the
hydrogenotrophic methanogens before use in the
enrichment of hydrogen-producing bacteria using glucose
as the sole carbon source. The melon fruit waste used in
this study collected from Gemah Ripah fruit market
located in Yogyakarta. The characteristics of the melon
waste were: water (92.30%), total solids (7.71%), ash
(1.25%) and volatile solid (6.48%). The melon slurry was
stored at 4°C until used as the hydrogen fermentation
substrate (Ruggeri and Tommasi, 2012).

Enrichment of H2 producing bacteria was carried out
in 100 mL serum vials with 50 mL working volume at
37oC, following a method described elsewhere
(Sivagurunathan et al., 2014). The sterile pre-reduced
peptone-yeast extract-glucose (PYG) medium contains
peptone 10 g/L, yeast extract 10 g/L, resazurin 0.001 g/L,
L-cysteine-HCl0.5 g/L, glucose 10 g/L. The pH adjusted to
7.0 using either 1 N HCl or NaOH before the autoclave.
Three successive transfers in PYG medium with 0.05%
cysteine-HCl were done to obtain the mixed-cultures FW,
CD, and TW from fruit waste, cow dung, and tofu waste
digester, respectively. Freshly grown (24 h) enriched
mixed cultures used as the inoculum for all the
fermentation experiments.
2.3 Batch hydrogen fermentation
A series of batch hydrogen fermentation tests were
carried out to check the hydrogen production performance
of individual and combined inoculum. Batch experiments
were carried out in serum vials (100 mL) with 50 mL
working volume under strict anaerobic condition. Five mL
of enriched culture was added as the inoculum to the
fermentation medium, following the method described by
Sivagurunathan et al. (2014). The batch hydrogen
fermentation of melon waste was carried out by the
individual, and combined inoculum in basal medium
contains volatile solid 9.65 g/L, Na2HPO4 5 g/L, KH2PO4 2
g/L, MgSO4·7H2O 0.50 g/L. The single inoculum was mixed
in equal volumes to prepare the combined inoculum. All
batch serum vials incubated in an incubator with
temperature controlled at 37OC. The initial cultivation pH
was adjusted to 7.0 using either 1 N HCl or NaOH before
the autoclave. The volatile fatty acids (VFA) analysed for
samples collected at the end of the fermentation.
Fermentation was carried out until the cessation of gas
production. All experiments were carried out in
duplicates, and the mean ± SD (standard deviation)
reported.

2.5 DNA extraction and PCR amplification
Total DNA extracted from bacterial cell pellet of H2
fermentation using Wizard® Genomic DNA extraction kit.
PCR was performed using 12.5µL Gotaq Green Master
Mix, one µl of each primer (10 µmole/L), one µL (10 ng/µL)
of template DNA, and 9.5 µL of nuclease-free water to give
a final volume of 25 µL. The first primer was amplified
with
16S
rDNA
using
27f
(5’GAGAGTTTGACTCTGGCTCAG-3’) and 1495r (5’CTACGGCTACCTTGTTACGA-3’). Those primers are

© IJRED – ISSN: 2252-4940, July 15th 2018 All rights reserved

Int. Journal of Renewable Energy Development 7 (2) 2018: 101-109

universal primer set (Liu et al., 2009). Bacterial 16S rDNA
were amplified at a temperature of 95OC for 3 min,
followed by 30 cycles at 95℃-30 sec, 55℃-30 sec, 72℃-1
min and the final extension at 72℃-5 min. The second
primers used for the PCR were EuB 984f with GC-clamps
(5’CGCCCGGGGCGCGCCCCCGGCGGGGCGGGGGCAC
GGGGGGAACGCGAACGCGAAGAACCTTAC-3’)
and
EuB1398r
(5’CGGTGTGTCCAAGGCCCGGGAACG-3’)
(Eurofins MWG Operon, Japan). The second primer target
was 500 bp reflecting a sequence of V6-8 region in 16S
rDNA. V6-8 regions were amplified using the following
program; 95℃ for 3 min, followed by 34 cycles at 95℃ for
15 sec, 55℃ for 30 sec, 72℃ for 30 sec and the final
extension at 72℃ for 5 min. The size of PCR product was
confirmed by electrophoresis in 1.3 % agarose gel in
ethidium bromide solution.
2.6 Analysis of Denaturing Gradient Gel Electrophoresis
(DGGE) bands
Digitized Denaturing Gradient Gel Electrophoresis
(DGGE) images were also analysed using gel compare II
software, version 6.6 (Applied Maths, Kortjnk, Belgium).
This software carries out relative intensity value of each
band to the total intensity of bands in all cultures.
Shannon index was calculated using (Eq.1.) and (Eq.2.) as
described below
H = − -./0 pi ln pi
2
EH =
= H/ ln S

(1)
(2)

2345

Where H is the value of the Shannon index, pi is the ratio
of the specific band intensity to the total intensity of all
bands. The Richness (S) of the bacterial community
determined from the number of bands in each lane (Sun et
al., 2015; Diez et al., 2001). Two matrices constructed; the
first took into account intensity of individual bands
related to intensities of the FW-CW7 band (intensity
matrix), whereas the second matrix (distance matrix)
measure the distance between individual band to FW-CW
7 bands. The intensity matrix was used to calculate
bacterial diversity. Both matrices were then used to
construct a non-metric multidimensional scaling (NMDS)

P a g e | 103

diagram. The diagram places each sample at a point in a
plane (with dimensions of no special significance). A
similar bacterial diversity index in inoculum combinations
will plot together.
2.7 Bacterial species identification
Predominant Denaturing Gradient Gel Electrophoresis
(DGGE) bands (1-16) were excised and eluted in 50 µL of
Mili-Q water at 4OC overnight. They were then were
centrifuged at 11,000xg for 2 min using MX-105
refrigerated microcentrifuge (Tomy Seiko, Japan). The
DNA concentration of the supernatant used as the
template for the next PCR using the second primer
without GC-clamps. PCR products were purified using the
FastGene Gel/PCR extraction kit (Nippon genetics, Japan)
and sequenced in DNA sequencer of Eurofins Company,
Japan. Basic local alignment search tool (BLAST) used to
evaluate the similarity sequence data of DGGE bands
with 16S rDNA reference sequences at GenBank
(http://www.ncbi.nlm.nih.gov). MEGA 6.0 software used
for phylogenetic tree construction.
3. Results and Discussion
3.1 Influence of origin of inoculum on hydrogen production
from melon waste
The anaerobic fermentation process includes four
biochemical functions, namely hydrolysis, acidogenesis,
acetogenesis, and methanogenesis. H2 products can obtain
during the acidogenesis and acetogenesis stages, whereas
methanogenesis used H2 as an electron donor and
converted to methane (CH4) (Mohan, 2009; Saady, 2013).
Therefore, hydrogenotrophic methanogens should be
inhibited or eliminated in the utilisation of anaerobic
microflora for H2 fermentation (Hawkes et al., 2007). The
inhibition did by acid treatment (pH 3; ±24 h) against the
seed sludge (Ren et al., 2008; Chang et al., 2011). The
results prove that H2-producing inoculum from fruit waste
(FW), cow dung (CD) and tofu waste (TW) digester are
capable of producing gas consisting of hydrogen (46 – 65%)
and carbon dioxide (35 – 54%). Methane was undetectable
for seven days of fermentation (Table 1).

Table 1.
Hydrogen production from melon waste in batch fermenter by Single inoculum from fruit waste (FW), cow dung (CD), and tofu waste
(TW) digester (37oC, start pH 7, volatile solid 9.65 g/L).
Total gas*

Total CO2*

Total H2*

Yield H2

Yield CO2

(mL/L)

(mL/L)

(mL/L)

(mL/g VS)

(mL/g VS)

4.67±0.01

1,254±28a

511±4

743±32d

207.56±14.61f

142.74±2.75

CD

4.66±0.04

796±65b

369±29

428±36e

129.74±9.82g

111.83±7.83

TW

4.64±0.01

641±25c

319±15

323±40e

92.39±12.41g

91.17±3.39

Inc.

Final pH

FW

Legend: *= gas volume at the standard conditions (1 atm. 25oC); different letter in the same column indicate significant difference statistically at the 0.05
level

Inoculum from fruit waste digester produces the highest
hydrogen (743 mL/L; yield 207.56 mL/gVS) among the
single inoculums. Sivagurunathan et al. [20] showed
similar results using three different inoculums, i.e., cow
dung (2,139 mL H2), sewage sludge (2,330 mL H2) and pig
slurry (1.633 mL H2). The result is supporting the notion

that the difference in the performance of hydrogen
production caused by the variation of species and number
of microbes that induce anaerobic digestion which is
affected by the type of substrate and operating conditions
applied on the biodigesters of natural consortium used as
inoculum (Akutsu et al., 2008).

© IJRED – ISSN: 2252-4940, July 15th 2018, All rights reserved

Citation: Amekan, Y., Wangi, D.S.A.P., Cahyanto, M.N., Sarto and Widada, J..(2018), Effect of Different Inoculum Combination on Biohydrogen Production from Melon
Fruit Waste. Int. Journal of Renewable Energy Development, 7(2), 101-109, doi.org/10.14710/ijred.7.2.101-109

P a g e | 104
decreased to 4.63 – 4.78 and hydrogen were not produced
under this condition (Fig. 1B).
1200

Cumulative Hydrogen Production (mL/L)

FW

CD

TW

1000

(A)
800

600

400

200

0
0

1

2

3

4

5

6

7

8

9

10

Time (day)
900

8
FW

800

CD

TW

FW pH

CD pH

TW pH

7

700

6

600

5

500
4

(B)

400

3

300

2

200

1

100
0

pH

Hydrogen Production Rate (mL/L.day)

Inoculum from fruit waste digester showed the highest
hydrogen production activity on day 1 of fermentation
(Fig. 1 A and B) which the hydrogen production rate was
reaching 559 mL/L.day. However, the production rate
slows to 127 mL/L.day in the next time span and reaches
the lowest point of 4 mL/L.day on the 5th day of
fermentation, before stopping on the 7th day. The same
trend observed for inoculum from cow dung and tofu waste
digester. This phenomenon is influenced by the degree of
acidity (pH) of the fermentation medium (Fig. 1B). High
hydrogen production rate indicates the optimal pH range,
i.e. FW has an optimal pH of 5.59 – 7.10, CD 5.63 – 7.04
(283 mL/L.day) and TW 5.71 – 7.10 (224 mL/L.day). The
pH values of all treatments correspond to the optimal pH
range of hydrogen production, i.e., 5.5 to 7 (Van Ginkel et
al., 2001; Fang and Liu, 2002; Khanal et al., 2004;
Kawagoshi et al., 2005).
The hydrogen production rate is high along with a
significant increase in the consumption of organic matter
over the same time span of 0.74 to 1.09 g/L (7 – 11%).
Rotten fruits (such as melon waste used in this study)
contain simpler and more easily degraded compounds
(e.g., glucose, sucrose, fructose, and maltose). When pH
conditions are optimal, acidogenic bacteria that produce
hydrogen will transform simple sugars into other products
to meet the needs of metabolism and cell growth. Such as
acetate together with the formation of ATP as an energy
source of cells and alcohol compounds are accompanied by
regeneration of nicotinamide adenine dinucleotide (NAD+)
of the reduced form NADH (an essential molecule for
continuing glycolysis) (Hallenbeck et al., 2012).
The hydrogen production rate is slower due to the
decrease in acidity (pH) of the fermentation media (Fig.
1B). Fermentative hydrogen production by acidogenic
bacteria in conjunction with the formation of short chain
fatty acids (volatile fatty acid/VFA) such as acetate,
butyrate, and propionate (Mohanakrishna et al., 2010;
Mohan et al., 2009). Inhibition of acetogenic bacteria and
methanogenic (acetoclastic and hydrogenotrophic) activity
led to the accumulation of VFA. Which resulted in a
decrease in pH and the cessation of production of H2 as
indicated by the slowing of hydrogen production rate (Lee
et al., 2008; Zhang et al., 2012; Srikanth and Mohan,
2014). According to Van Ginkel et al. (2001) and Das et al.
(2014), the inhibition process occurs when a non-polar
undissociated acid penetrates into the cell and releasing
protons that would destabilise the intracellular pH and
cause denaturation of intracellular enzymes, including
hydrogenases (essential hydrogen-producing enzyme).
The pH of the media at the end of the fermentation process

0

1

2

3

4

5
Time (day)

6

7

8

9

10

0

Figure 1. Cumulative production* (A), hydrogen production rate
and pH profile (B) during dark fermentation of melon waste by
inoculum from fruit waste digester (FW;
;
), cow dung
digester (CD;
;
) and tofu waste digester (TW;
;
) (37OC, start pH 7). *= gas volume at the standard
conditions (1 atm, 25OC); Error bar represented deviation
standard of experimental data.

3.2 Effect of the combination of inoculum from different
anaerobic digester on hydrogen production from melon
waste
Inoculum from fruit waste (FW), cow dung (CD), and
tofu waste (TW) digester are combined to see the effect of
increased microbial diversity on hydrogen production
performance. The low pH treatment (pH 3; ± 24 hours) was
able to limit the activity of the hydrogen users' bacteria,
especially methanogens, which were active in a narrow pH
range of 6.3 – 7.8. It proved that no methane (0%) was
found to 7 days of hydrogen fermentation of melon waste,
although the batch test performed at an initial pH of 7.05
± 0.05. The test results showed that four combined
treatments were capable of producing gases comprising H2
(744 – 1,132 mL/L) and CO2 (586 – 792 mL/L) (Table 2).

Table 2.
Hydrogen production from melon waste in batch fermenter by combined inoculum from fruit waste digester (FW), cow dung digester (CD),
tofu waste digester (TW) (37oC, start pH 7, volatile solid 9.65 g/L)
Inc.

Final pH

Total gas*
(mL/L)

Total CO2*
(mL/L)

Total H2*
(mL/L)

Yield H2
(mL/gVS)

Yield CO2
(mL/gVS)

FW-CD
CD-TW
FW-TW
FW-CD-TW

4.71±0.01
4.70±0.09
4.65±0.06
4.68±0.03

1,549±98a
1,387±69b
1,804±75c
1,902±70c

546±57
643±30
728±8
770±31

1,003±41d
744±39e
1,077±67d,f
1,132±39f

288.30±0.66g
173.48±0.70h
195.15±7.13i
231.02±1.62j

156.75±10.21
150.06±1.52
131.97±2.01
157.20±2.04

Legend: Inoculum combination of fruit waste and cow dung digester (FW-CD). Inoculum combination of cow dung and tofu waste digester (CD-TW). Inoculum
combination of tofu waste and fruit waste digester (FW-TW). Inoculum combination of fruit waste, cow dung, and tofu waste digester (FW-CD-TW). *= gas
volume at the standard conditions (1 atm, 25oC); different letter in the same column indicate significant difference statistically at the 0.05 level.

© IJRED – ISSN: 2252-4940, July 15th 2018 All rights reserved

Int. Journal of Renewable Energy Development 7 (2) 2018: 101-109

Increased in diversity and interaction between
microbial effects the hydrogen production performance.
The combination of inoculum can increase the total
hydrogen production (Table 2; Fig. 2) 1.74 to 3.50 times
compared to the single inoculum. The combination of FWCD-TW produces the highest hydrogen compared to the
combination of FW-CD, FW-TW, CD-TW, and its sole
inoculum. These results indicate that the inoculum from
different bio digesters able to adapt well to the
environmental conditions and the new substrate after a
combination process as a result of metabolic flexibility
derived from the microbial diversity in the community.

Cumulative Hydrogen Production (mL/L)

1200

1000

800

reaches a low of 7 – 11 mL/L.day on the 5th day of
fermentation, before stopping on the day-7. This
phenomenon is similar to the batch test of single
inoculum. Hydrogen production associated with VFA
formation. The production and accumulation of acid
metabolites gradually reduce the medium buffer capacity,
so the pH of the medium decreases during the
fermentation process (see Fig. 2B). The pH of inoculum
and combination batch test media during fermentation
showed a similar pattern. Hydrogen not produced by all
tests in the pH range of 4.7 – 4.8.
The batch test showed an increase in the yield and
hydrogen production rate by four treatment combinations
of inoculum up to 1.35 – 3.51 times of individual
inoculums. Similarly, Sivagurunathan et al. (2014) using
cow dung, sewage sludge and pig slurry show increase of
1.07 to 1.52 times. These results prove that increasing
species diversity and microbial interactions due to
combinations have a positive effect on improved hydrogen
production performance.
3.3 Metabolic end-products of hydrogen fermentation by
individual and combined inoculum

600

(A)

400

FW-CD
CD-TW

200

FW-TW
FW-CD-TW

0

0

2

4

6

8

10

Time (day)

8

900
800

FW-CD

CD-TW

FW-TW

FW-CD-TW

FWCD pH

CDTW pH

FWTW pH

FWCDTW pH

7

700

6

600

5

500
4

pH

Hydrogen Production Rate (mL/L/day)

P a g e | 105

400
3

(B)

300

2

200

1

100

0

0
0

1

2

3

4

5

6

7

8

9

Fermentative hydrogen production by all treatments
associated with the formation of volatile fatty acid (VFA)
under anaerobic/acidogenic conditions. The pattern of
VFA in mixed culture fermentation gives a general
indication of the concerted metabolism of the community
and affects the process performance directly (Ni et al.,
2014) as a result of the collective metabolism of mixed
culture directly influences the hydrogen yield. The
maximum theoretical yield of 4 mole and 2 mole of
hydrogen could produce when acetic acid and butyric acid.
Respectively are the sole end-product of fermentation.
However, the yield significantly drops in case of mixed
culture showing mixed-type fermentation due to the
accumulation of other end-products like propionic, valeric,
and caproic (Lee et al., 2008). As shown in Fig. 3, the VFA
composition of single and combined inoculum's
fermentation media constituted mainly butyrate (HBu)
and acetate (HAc). The range of HAc fraction in VFA was
at 20 – 60%. On the other hand, the scope of HBu fraction
was at 6.39 – 18.74%.

10

Time (day)

Figure 2. Cumulative production (A), hydrogen production rate
and pH profile (B) during dark fermentation of melon waste by
combined inoculum from fruit waste digester (FW), cow dung
digester (CD) and tofu waste digester (TW) (37OC, start pH 7). *=
gas volume at the standard conditions (1 atm, 25OC); Error bar
represented deviation standard of experimental data.

Microbial metabolic and physiological diversity means
that there are a variety of pathways are utilised by
different microbes to produce hydrogen (Hallenbeck and
Benemann, 2012). Batch test results prove that the
inoculum combination increases the hydrogen production
capability. FW inoculum (129.74 mL/g; HPR 85.50
mL/L.d) and TW inoculum (92.39 mL/g; HPR 64.50
mL/L.d) has higher yield and hydrogen production rate
after combination FW-TW (173.48 mL/g; 148.70 mL/L.d).
Four inoculum combination tests had the highest rate
of hydrogen production (Fig. 2B) on day 1 of fermentation,
i.e., 570 – 786 mL/L.day. However, the production rate
falls to 110 – 215 mL/L.day in the next time span and

Figure 3. The percent fraction of VFA and total VFA
concentration

© IJRED – ISSN: 2252-4940, July 15th 2018, All rights reserved

Citation: Amekan, Y., Wangi, D.S.A.P., Cahyanto, M.N., Sarto and Widada, J..(2018), Effect of Different Inoculum Combination on Biohydrogen Production from Melon
Fruit Waste. Int. Journal of Renewable Energy Development, 7(2), 101-109, doi.org/10.14710/ijred.7.2.101-109

P a g e | 106
Hydrogen fermentation by individual inoculum from
fruit waste digester produce total organic acids 1821.73
mg/L consisting of acetic 1056.30 mg/L (57.98%), butyric
341.40 mg/L (18.74%), formic 124.25 mg/L (6.8%),
propionic 149.38 mg/L (8.20%), valeric 64.30 mg/L (3.53%)
and caproic 86.10 mg/L (4.73%). Variation of the final
metabolite indicates the diversity of metabolic pathways
used by acidogenic microflora in inoculum within seven
days of the fermentation process. Pyruvate produced by
EMP (Embden-Meyerhoff Pathway) dominantly converted
to acetate because in the biochemical reactions of acetate
formation occurs NADH regeneration and allow microbes
to synthesise ATP (Saady, 2013). Butyrate formed when
the hydrogen partial pressure increased (> 60 Pa) to
prevent the accumulation of NADH (Saady, 2013).
Therefore, the acidogenic bacteria present in the FW has
the best hydrogen production capability among CD and
TW. Individual inoculum from fruit waste digester (FW)
exploit acetate formation pathway for the oxidative
decarboxylation of pyruvate and also produce hydrogen
through NADH. However, the high production of propionic
acid during the batch test of TW (23.38 mmole/L)
compared to the FW and CD, each produces 2.02 and 4.21
mmole/L, causing the smaller volume of the hydrogen
produced.
The FW-CD combination dominantly oxidises
pyruvate to acetate, which is 499.63 mg/L (48.73%), due to
the NADH regeneration and allow microbes to synthesise
ATP (Saady, 2013). The CD-TW combination exploits
propionate formation pathways during fermentation
which the concentration of propionic reach 1049.20 mg/L
(47.71%). Bio reaction of propionate formation consume
H2 as an electron donor in the form of reducing
equivalents (NADH2; potential H2) (Fang and Liu, 2002)
causing this treatment has the lowest hydrogen
production capability than any other combination. The
rank of hydrogen yield of the combination treatment: FWCD-TW (yield 231.02 mL/g; propionate 28.86%) > FW-TW
(yield 195.15 mL/g; propionate 42.22%) > CD-TW (yield
173.48 mL/g; propionate 47.71%). These results prove that
higher production of propionic acid decrease hydrogen
yield.
The results show that increased in diversity and
interactions between microbes effect the yield and
hydrogen production rate from the melon waste in batch
fermenters. The FW-CD-TW combination shows the best
hydrogen production capability compared to CD-TW, FWCD, CD-TW and single inoculum. Acetate and formic
metabolic pathways are used dominantly by the two best
combinations during the fermentation process. However,
combinations involving the inoculum from the tofu waste
digester exhibit a high propionate-forming activity
thereby decreasing the hydrogen yield.
3.4 Microbial community analysis
DNA samples collected from all of the treatments at 0,
1, and 7 days of fermentation to see the change in the
microbial community during the hydrogen fermentation
process. This study found that carbon source replacement
using melon waste affect the microbial abundance without
any changes in the microbial community that involved in

the
fermentation.
Denaturing
Gradient
Gel
Electrophoresis (DGGE) analysis of the 16s rDNA of single
and combined inoculums showed that the microbial
community was composed principally of five genera, i.e.,
Clostridium, Eubacterium, Vagococcus, Streptococcus, and
Lactobacillus (Fig. 4 and Fig. 5). Interestingly, although
FW and TW inoculum have same bacterial species
richness and diversity index (lane 2 and 3 on DGGE
profiles), FW produces higher hydrogen than TW. The only
reason is the high production of propionic acid during
fermentation of TW as mentioned before.

Figure 4. 16S rDNA profiles of H2 fermenting bacteria from
combinations of different inoculum. Lanes 1-3: individual
cultures from cow-dung (CD), fruit waste (FW), tofu waste (TW),
respectively. Lane 4-18 were combined inoculum took on 0, 1 and
7 day of fermentation. Lanes 4-6: fruit+cow-dung+tofu (FW-CDTW); 7-9: fruit+tofu (FW-TW); 10-12: fruit+cow-dung (FW-CD);
13-15: fruit (FW); 16-18: cow-dung+tofu (CD-TW). Bands 1-16
were sequenced for identification of bacterial species.

All bacterial species observed in all treatments usually
found in H2 fermentation that using active sludge from
wastewater as inoculum (Choin and Ahn, 2014; Kumar et
al., 2015). The role of Vagococcus salmoninarium and
Methylobacterium sp. in hydrogen fermentation was not
well known yet. All bacteria in this study belong to
Proteobacteria
and
Firmicutes
phyla.
Phylum
proteobacteria have high ability to adapt and could break
down large organic compounds into the simple compound.
Phylum Firmicutes often plays a role in hydrogen
fermentation (Jang et al., 2015). Inoculum source that
used in this study had a source of the potential hydrogenproducing bacteria, i.e. Clostridium baratii and
Clostridium perfringens, which always observed in day 1
of fermentation (peak of hydrogen production) in all
treatments.
All single and combination of inoculums were not
produce hydrogen 7 days of fermentation. It reflected from
the Denaturing Gradient Gel Electrophoresis (DGGE)
profiles and bacterial diversity index which showed
Lactobacillus paracasei prominently detected during this
time point. Noike et al. (2002) reported that Lactobacillus
paracasei could inhibit the H2 fermentation by produced
bacteriocin in a medium under pH 5.

© IJRED – ISSN: 2252-4940, July 15th 2018 All rights reserved

Int. Journal of Renewable Energy Development 7 (2) 2018: 101-109

P a g e | 107

Figure 5. Phylogenetic trees analysis based on Denaturing Gradient Gel Electrophoresis (DGGE) profile. The branching pattern
generated by the neighbour-joining method. The topology shown was obtained using 1000 bootstrap replication. The numbers at the nodes
indicate the levels of bootstrap support percentage based on 1000 re-samplings.

4. Conclusion
This study demonstrated that increased in diversity
and interaction between microbial effects the hydrogen
production performance. The combination of inoculum can
increase the total hydrogen production. Among the
individual and combined inoculums, the highest
cumulative hydrogen production of 743 mL/L (yield 207.56
mL/g) and 1,132 mL/L (yield 231.02 mL/g) shown by
inoculum from fruit waste digester and the combination of
inoculum from fruit waste-cow dung-tofu waste digester.
Butyric, acetate, formic and propionic were the primary
soluble metabolites produced by all the cultures, and the
result proves that higher production of propionic acid can
decrease hydrogen yield. Inoculum that used in this study
had a source of the potential hydrogen-producing bacteria,
i.e. Clostridium baratii and Clostridium perfringens.
Experimental
evidence
suggests
that
hydrogen
fermentation by inoculum combination could use as a
strategy to improve systems for on-farm energy recovery
from animal and plant waste to processing of food and
municipal solid waste.
Acknowledgments
This study was supported by Indonesia Endowment Fund
for Education (LPDP) to the first author and Short-Term
Exchange Program in science and engineering at Tokyo
University of Agriculture and Technology to the second
author

References
Akutsu Y., Li Y., Tandukar M., Kubota K., et al. (2008). Effects of
seed sludge on fermentative characteristics and microbial
community structures in thermophilic hydrogen fermentation
of starch. International Journal of Hydrogen Energy. 33,
6541-6548.
American Public Health Association, American Water Works
Association, and Water Environment Federation, Standard
methods for the examination of water and wastewater. 20th
ed, APHA, AWWA, and WEF. Washington D.C. (USA): 1998.
Cai J.L., Wang G.C., Li Y.C., et al. (2009). Enrichment and
hydrogen production by marine anaerobic hydrogenproducing Microflora. Chinese Science Bulletin. 54, 2656–
2661.
Cahyari K., Syamsiah S., Sarto, et al. (2011). Hydrogen
production from fruit waste through dark fermentation. 4th
conference of Hydrogen and Fuel Cells in The Nordic
Countries. Malmö. Sweden. 25–26 October 2011.
Chang S., Li J.Z., Liu F. (2011). Evaluation of different
pretreatments methods for preparing hydrogen-producing
seed inocula from waste activated sludge. Renewable Energy.
36, 1517–1522.
Choi J, Ahn Y. (2014). Characteristics of biohydrogen
fermentation from various substrates. International Journal
of Hydrogen Energy. 39, 3152–3159.
Choi J., Ahn Y. (2015). Biohydrogen fermentation from Sucrose
and Piggery Waste with High Levels of Bicarbonate
Alkalinity. Energies, 8, 1716–1729.
Das D., Veziroglu T.N. (2001). Hydrogen production by biological
processes: a survey of literature. International Journal of
Hydrogen Energy, 26, 13–28.

© IJRED – ISSN: 2252-4940, July 15th 2018, All rights reserved

Citation: Amekan, Y., Wangi, D.S.A.P., Cahyanto, M.N., Sarto and Widada, J..(2018), Effect of Different Inoculum Combination on Biohydrogen Production from Melon
Fruit Waste. Int. Journal of Renewable Energy Development, 7(2), 101-109, doi.org/10.14710/ijred.7.2.101-109

P a g e | 108
Das D., Khanna N., Dasgupta C.N. (2014). Biohydrogen
Production Fundamentals and Technology Advances. CRC
Press Taylor & Francis Group.
Díez B., Pedrós-Alió C., Marsh T.L., et al. (2001). Application of
denaturing gradient gel electrophoresis (DGGE) to study the
diversity of marine picoeukaryotic assemblages and
comparison of DGGE with other molecular techniques.
Application of Environmental Microbiology. 67, 2942–2951.
Fang H.H.P., Liu H. (2002). Effect of pH on hydrogen production
from glucose by a mixed culture. Bioresource Technology. 82,
87–93.
Hallenbeck P.C., Abo-Hashesh M., Ghosh D. (2012). Review:
Strategies for improving biological hydrogen production.
Bioresource Technology. 110, 1–9.
Hallenbeck P.C., Benemann J.R. (2012). Biological hydrogen
production;
fundamentals
and
limiting
processes.
International Journal of Hydrogen Energy. 27, 1185–1193.
Han S.K., Shin H.S. (2004). Biohydrogen production by anaerobic
fermentation of food waste. International Journal of
Hydrogen Energy, 29, 569–577.
Hawkes F.R., Hussy I., Kyazze G., et al. (2007). Continuous dark
fermentative hydrogen production by mesophilic microflora:
Principles and progress. International Journal of Hydrogen
Energy. 32, 172–184.
Insam H., Franke-Whittle I., Goberna M. (2010). Microbes at
Work: from waste to resources. Springer-Verlag Berlin
Heidelberg.
Jang S., Kim D.H., Yun Y.M., et al. (2015). Hydrogen
fermentation of food waste by alkali-shock pretreatment:
Microbial community analysis and limitation of continuous
operation. Bioresources and Technology. 186, 215–222.
Kapdan I.K., Kargi F. (2006). Bio-hydrogen production from
waste materials. Enzyme and Microbial Technology. 38, 569–
582.
Karthic P., Joseph P. (2012). Comparison and Limitations of
Biohydrogen Process. Research Journal of Biotechnology, 7,
59–71
Kawagoshi Y., Hino N., Fujimoto A., et al. (2005). Effect of
inoculum conditioning on hydrogen fermentation and pH
effect on bacterial community relevant to hydrogen
production. Journal of Bioscience and Bioengineering. 100,
524–530.
Khanal S.K., Chen W.H., Li L., et al. (2004). Biological hydrogen
production: effects of pH and intermediate products.
International Journal of Hydrogen Energy. 29, 1123–1131.
Kumar G., Bakonyi P., S Periyasamy., et al. (2015). Lignocellulose
biohydrogen: practical challenges and recent progress.
Renewable and Sustainable Energy Rev., 44, 728–737.
Kumar G., Bakonyi P., Sivagurunathan P., et al. (2015).
Enhanced biohydrogen production from industrial beverage
wastewater
using
external
nitrogen
sources
and
bioaugmentation with facultative anaerobic strains. Journal
of Bioscience and Bioengineering. 120, 155–160.
Lee H.S., Salerno M.B., Rittmann B.E (2008). Thermodynamic
evaluation on H2 production in glucose fermentation.
Environmental Science and Technology. 42, 2401-2407.
Li Z., Wang H., Tang Z., Wang X., et al. (2008). Effects of pH value
and substrate concentration on hydrogen production from the
anaerobic fermentation of glucose. International Journal of
Hydrogen Energy. 13, 1–6.
Liu H., Wang G., Zhu D., et al. (2009). Enrichment of the
hydrogen-producing microbial community from marine
intertidal sludge by different pretreatment methods.
International Journal of Hydrogen Energy. 34, 9696–9701.
Mohan, S.V. (2009). Harnessing of biohydrogen from wastewater
treatment using mixed fermentative consortia: Process
evaluation towards optimization. International Journal of
Hydrogen Energy. 34, 7460–7474.
Mohan S.V., Babu M.L., Reddy M.V., et al. (2009). Harnessing of
biohydrogen by acidogenic fermentation of Citrus limetta
peelings: effect of extraction procedure and pretreatment of

biocatalyst. International Journal of Hydrogen Energy. 34,
6149–6156.
Mohanakrishna G., Mohan S.V., Sarma P.N. (2010). Utilizing
acid-rich effluents of fermentative hydrogen production
process as substrate for harnessing bioelectricity: an
integrative approach. International Journal of Hydrogen
Energy. 35, 3440–3449.
Nath K., Das D. (2004). Improvement of Fermentative Hydrogen
Production: Various Approaches. Appl. Microbiology and
Biotechnology, 65, 520–529.
Ni B. J., Rittmann B.E., Yu H.Q. (2011). Soluble microbial
products and their implications in mixed culture
biotechnology. Trends Biotechnology. 29, 454-463.
Noike T., Takabatake H., Mizuno O., et al. (2002). Inhibition of
hydrogen fermentation of organic wastes by lactic acid
bacteria. International Journal of Hydrogen Energy. 1367–
1371.
Pachapur V.L., Sarma S.J., Brar S.K., et al. (2015). Co-culture
strategies
for
increased
biohydrogen
production.
International Journal of Energy Research, 39, 1479–1504.
Pattra S., Sangyoka S., Boonmee M., et al. (2008). Bio-hydrogen
production from the fermentation of sugarcane bagasse
hydrolysate by Clostridium butyricum. International Journal
of Hydrogen Energy. 33, 5256–5265.
Reith J.H., Wijffels R.H., Barten H. (2003). Bio-methane and biohydrogen – status and perspective of biological methane and
hydrogen production. Dutch Biological Hydrogen Foundation:
The Hague.
Ren N.Q., Guo W.Q., Wang X.J., et al. (2008). Effects of different
pretreatment methods on fermentation types and dominant
bacteria for hydrogen production. International Journal of
Hydrogen Energy. 33, 4318–4324.
Ruggeri B., Tommasi T. (2012). Efficiency, and efficacy of pretreatment and bioreaction for bio-H2 energy production from
organic waste. International Journal of Hydrogen Energy. 37,
6491–6502.
Ruknongsaeng P., Reungsang A., Moonamart S., et al. (2005).
Influent of nitrogen, acetate, and propionate on hydrogen
production from pineapple waste extract by Rhodospirillum
rubrum. Journal of Water Environment. Technol. 13, 93–117.
Saady, N.M.C. (2013). Homoacetogenesis during hydrogen
production by mixed cultures dark fermentation: Unresolved
challenge. International Journal of Hydrogen Energy. 38,
13172–13191.
Sivagurunathan P., Sen B., Lin C.Y. (2014). Batch fermentative
hydrogen production by enriched mixed culture: Combination
strategy and their microbial composition. Journal of
Bioscience Bioengineering. 117, 222–228.
Sivagurunathan P., et al. (2016). A critical review on issues and
overcoming strategies for the enhancement of dark
fermentative hydrogen production in continuous systems.
International
Journal
of
Hydrogen
Energy,
http://dx.doi.org/10.1016/j.ijhydene.2015.12.081
Sivagurunathan P., Anburajan P., Kumar G., et al. (2016).
Improvement of hydrogen fermentation of galactose by
combined inoculation strategy. J. Biosci. Bioeng. XX, 1–5.
http://dx.doi.org/10.1016/j.jbiosc.2016.10.006
Srikanth S., Mohan S.V. (2014). Regulating feedback inhibition
caused by the accumulated acid intermediates during
acidogenic hydrogen production through feed replacement.
International Journal of Hydrogen Energy. 39, 10028–10040.
Sun W., Liu J., Xu H., et al. (2015). l-Lactic acid fermentation by
Enterococcus faecium: a new isolate from bovine rumen.
Biotechnology Letter. 37, 1379–1383.
Tien H.M., Le K.A., Tran A. T., et al. (2016). Effect of
fermentation condition on biohydrogen production from
cassava starch by anaerobic mixed cultures. The 3rd
AUN/SEED-NET
Regional
Conference
on
Energy
Engineering and the 7th International Conference on
Thermofluids
(RCEnE/THERMOFLUID
2015).
doi:
10.1063/1.4949310.

© IJRED – ISSN: 2252-4940, July 15th 2018 All rights reserved

Int. Journal of Renewable Energy Development 7 (2) 2018: 101-109

Van Ginkel S., Sung S.W., Lay J.J. (2001). Biohydrogen
production as a function of pH and substrate concentration.
Environmental Science and Technology. 35, 4726–4730.
Yokoi H., Saitsu A., Uchida H., et al. (2001). Microbial Hydrogen
Production from Sweet Potato Starch Residue. Journal of
Bioscience Bioengineering, 91, 58–63.

P a g e | 109

Zhang L., Li J., Ban Q., et al. (2012). Metabolic pathways of
hydrogen production in fermentative acidogenic microflora.
Journal of Microbiology and Biotechnology. 22, 668–67

© IJRED – ISSN: 2252-4940, July 15th 2018, All rights reserved