The Indonesian Biomedical Journal.
Vol.
No.
June 2025, p.
Print ISSN: 2085-3297.
Online ISSN: 2355-9179
RESEARCH ARTICLE
MLC 901 Decreases HSP-70.
MMP-9.
Cerebral Infarction Volume and Functional Outcome in Acute Ischemic Stroke Rat Model Ilsa Hunaifi1,2.
Andi Kurnia Bintang3,E.
Jumraini Tammasse3.
Isra' Wahid4.
Mohammad Hatta5.
Andi Asadul Islam6.
Andi Alfian Zainuddin7.
Paulus Sugianto8 Department of Neurology.
Faculty of Medicine and Health Sciences.
Universitas Mataram.
Jl.
Pendidikan No.
Mataram 83125.
Indonesia Doctoral Program.
Faculty of Medicine.
Universitas Hasanuddin.
Jl.
Perintis Kemerdekaan No.
Km.
Makassar 90245.
Indonesia Department of Neurology.
Faculty of Medicine.
Universitas Hasanuddin.
Jl.
Perintis Kemerdekaan No.
Km.
Makassar 90245.
Indonesia Department of Parasitology.
Faculty of Medicine.
Universitas Hasanuddin.
Jl.
Perintis Kemerdekaan No.
Km.
Makassar 90245.
Indonesia Department of Microbiology.
Faculty of Medicine.
Universitas Hasanuddin.
Jl.
Perintis Kemerdekaan No.
Km.
Makassar 90245.
Indonesia Department of Neurosurgery.
Faculty of Medicine.
Universitas Hasanuddin.
Jl.
Perintis Kemerdekaan No.
Km.
Makassar 90245.
Indonesia Department of Public Health.
Faculty of Medicine.
Universitas Hasanuddin.
Jl.
Perintis Kemerdekaan No.
Km.
Makassar 90245.
Indonesia Department of Neurology.
Faculty of Medicine.
Universitas Airlangga.
Jl.
Prof.
Dr.
Moestopo No.
Surabaya 60132.
Indonesia *Corresponding author.
Email: a.
kurnia_b@yahoo.
Received date: Mar 4, 2025.
Revised date: May 6, 2025.
Accepted date: May 9, 2025 Abstract ACKGROUND: Acute ischemic stroke (AIS) is usually treated with thrombolysis, however the percentage of patients receiving this therapy is not quite low.
Therefore, it is necessary to find alternative therapy using neuroprotective agent such as Moleac (MLC) 901.
Heat shock proteins (HSP)-70 and matrix metalloproteinase (MMP)-9 are usually related to AIS due to the triggered stroke-induced physiological stress.
However, the effect of MLC 901 on Hsp70 mRNA expression.
HSP-70 and MMP-9 remains unclear.
This study was conducted to determine the effect of MLC 901 on those three parameters in relation to cerebral infarction volume and functional outcomes in an AIS model.
METHODS: Rats were induced with AIS using unilateral common carotid artery occlusion (UCAO) and received three different treatments: 43.
2 mg/200 gBW MLC 901, 21.
6 mg/200 gBW MLC 901, and sodium carboxymethyl cellulose (CMC-N.
, that were administered orally for 14 days.
HSP-70 and MMP-9 protein levels were assessed using enzyme-linked immunosorbent assay (ELISA), and Hsp70 mRNA expression was assessed using quantitative realtime polymerase chain reaction .
RT-PCR).
Foot fault scores for evaluation functional outcome and infarction volume were assessed by ImageJ.
RESULTS: AIS-induction increased HSP-70.
MMP-9, and Hsp70 mRNA expression within 24-48 h.
MMP-9.
HSP-70 , and Hsp70 mRNA expression were reduced by MLC 901.
MLC 901 at dose of 43.
2 mg/200 gBW and 21.
6 mg/200 gBW were effective in reducing these levels compared to the control.
MLC 901 improved functional outcomes and decreased cerebral infarction volume.
Moreover, a dosage of 43.
2 mg/200 gBW was more effective in reducing Hsp70 mRNA expression and HSP-70, improving functional outcomes, and reducing cerebral infarction volume than a dosage of 21.
6 mg/200 gBW, but not MMP-9 protein.
CONCLUSION: MLC 901 effectively decreased Hsp70 mRNA expression.
HSP-70 and MMP-9 protein levels, infarct volume, and functional outcomes.
MLC 901 could be a potential therapeutic agent for AIS.
KEYWORDS: MLC 901.
HSP-70.
MMP-9, acute ischemic stroke Indones Biomed J.
: 252-62
Copyright A 2025 The Prodia Education and Research Institute.
This work is licensed under a Creative Commons Attribution-NonCommercial 4.
0 International (CC-BY-NC) License.
DOI: 10.
18585/inabj.
Introduction MLC 901 Decreases HSP-70.
MMP-9, and Cerebral Infarction Volume (Hunaifi I, et al.
Indones Biomed J.
: 252-62
Stroke is a leading contributor to mortality and disability worldwide, with a higher incidence in less-affluent nations.
In Indonesia, there are an increase in stroke prevalence 9 cases per 1,000 individuals, up from 7 cases per 1,000 in 2013.
The impact of stroke is significant, since almost half of stroke patients are having permanent disability and are unable to return to work.
Acute ischemic stroke (AIS) is the most common type of stroke, which is a condition caused by a blockage in a blood vessel supplying blood to the brain, resulting in reduced blood flow and potential brain damage.
Intravenous thrombolysis is the standard treatment for AIS, but most of times it cannot be performed and only around 9.
1% of Asian patients receive this therapy.
Therefore it is necessary to have alternative therapy for AIS, and research into neuroprotective strategies such as Moleac (MLC) 901 is particularly promising.
The complexity of the cerebral ischemia cascade is such that a single neuroprotective intervention is insufficient to prevent brain damage.
This therapy targets multiple molecular and cellular mechanisms, thereby mitigating cerebral ischemia during the acute phase.
Herbal remedies such as Astragali radix and Prunus persica may offer protection against ischemia-reperfusion injury, reduce neuroinflammation and oxidative stress, enhance brain microcirculation, and modify microglial polarization.
Studies have shown that MLC 901 inhibits the expression of peroxiredoxin-6 (Prx-.
, nuclear factor kappa beta (NF-B), and toll-like receptor (TLR)-4 following middle cerebral artery occlusion (MCAO).
Research on MLC 901 for traumatic brain injury has shown that taking 0.
8 gram of MLC 901 .
wo capsule.
three times daily for six months lead to enhancement in executive function and attention.
However, the optimal oral dose for AIS remains Intraperitoneal injection of MLC 901 at 40 AAg/kg body weight can prevent brain injury, maintain the bloodbrain barrier, and reduce cerebral oedema.
Moreover, this treatment has been shown to mitigate neurological deficits in cerebral ischemia by suppressing the mRNA expression of inflammatory cytokines.
Stroke-induced physiological stress triggers the production of heat stroke protein (HSP)-70 and other HSPs.
HSP-70 is reported to suppress NF-B, thereby reducing matrix metalloproteinase (MMP-.
Additionally, it works in conjunction with mitogen-activated protein kinase (MAPK) to modulate various cellular functions, including migration, apoptosis, differentiation, proliferation, and metabolism.
Considering the increased MAPK levels following stroke.
HSP-70 is being considered as a potential therapeutic target for ischemic stroke.
Moreover, the disparity between intracellular and extracellular HSP-70 has been suggested as a possible factor in the development of chronic diseases.
Studies have revealed that extracellular HSP-70 stimulates the release of pro-inflammatory molecules via TLR 2/4 through the action of myeloid differentiation factor 88 (MyD.
Currently, no studies have investigated the efficacy of MLC 901 on Hsp70 mRNA expression.
HSP-70 and MMP9 protein expression, functional outcomes, and cerebral infarction volume.
Hence it is vital to investigate the efficacy of MLC 901 on these biomarkers in AIS.
Research using experimental animal models of AIS should be undertaken to determine its safety and efficacy prior to advancing its therapeutic use in humans.
This study was conducted to determine the efficacy of MLC 901 in modulating the expression of Hsp70 mRNA.
HSP-70 and MMP-9 proteins, functional outcomes, and magnitude of cerebral infarction Methods Animal Preparation Twenty-four adult male rats, weighing between 200 and 300 grams, aged 10Ae12 weeks, were procured from the Department of Agriculture and Food Security in Maros Regency.
South Sulawesi.
The rats were housed in a controlled environment, maintained at a temperature of 25A2AC and a humidity level of 60A10%, with unrestricted access to water and food.
All experimental protocols were conducted at the Molecular Biology and Immunology Laboratory.
Universitas Hasanuddin.
Makassar.
The experiment protocol was approved by The Ethical Committee of Universitas Hasanuddin/Universitas Hasanuddin Teaching Hospital/Wahidin Sudirohusodo General Hospital (No.
629/UN4.
31/PP36/2.
Every attempt was made to reduce the quantity of animals used in each group and to minimize suffering of the animals.
Drug Administration Neuroaid II MLC 901 (Moleac Singapore.
Singapor.
comprises of nine herbal extracts, including Radix salvia miltiorrhizae.
Radix astragali.
Radix paeoniae rubra.
Radix angelicae sinensis.
Radix polygalae.
Rhizoma chuanxiong.
Carthamus tinctorius.
Prunus persica, and Acori tatarinowii The Indonesian Biomedical Journal.
Vol.
No.
June 2025, p.
Print ISSN: 2085-3297.
Online ISSN: 2355-9179 Tetramethylpyrazine (TMP), ligustilide, ferulic acid, hydroxyl safflower yellow A (HSYA), -Asarone, total paeony glycoside (TPG), astragaloside IV (AST), presenegenin, salvianolic acid B (SAB), and tanshinone IIB (TSB) are among its active ingredients.
MLC 901 was administered with rat oral gavage 90 minutes after stroke induction and continuing once daily for 14 days.
The dosage for rats was calculated based on previously established human equivalent doses.
to reveal the left common carotid artery along the midline of the neck.
A bulldog clamp was then applied to occlude the artery for 180 minutes.
Following the occlusion period, the clamp was removed to allow reperfusion (Figure .
AIS Model and Treatment Procedure Following an acclimatization period, three groups of rats were randomly selected .
=8 per grou.
: .
AIS rats treated 2 mg/200 gBW MLC 901.
AIS rats treated with 6 mg/200 gBW MLC 901.
AIS rats treated with 25% sodium carboxymethyl cellulose (CMC-N.
as a negative control (NC).
The unilateral common carotid artery occlusion (UCAO) technique was used to generate AIS.
MLC 901 and CMC-Na was administered 90 minutes post-induction.
Given that this model closely replicates the clinical presentation of AIS in humans, a normal control group was not included.
Treatment was initiated post-acute ischemic stroke critical phase to enhance neuroprotection.
The experimental design and the study timeline was illustrated in Figure 1.
The UCAO technique, as described in a previous study, was used to establish the AIS model.
An intraperitoneal injection of a mixture of 10 mg/kgBW xylazine and 80 mg/ kgBW ketamine was used to anesthetize the rats.
While under anesthesia, the rats were positioned supine on a surgical table.
A small incision, 1Ae2 cm in length, was made 2 mg of MLC 901 Day 1 Day 2 Measurement of Hsp70 mRNA Expression Using Quantitative Real Time-PCR .
RT-PCR) Samples of blood were taken at baseline .
rior strok.
, 24 hours .
, 48 hours .
, and 336 hours .
post-AIS.
Nucleic acid extraction and measurement of Hsp70 mRNA expression were performed according to established protocols.
The target geneAos expression profile was identified using qRT-PCR, with expression levels represented as the ratio of the specific gene of interest to that of the housekeeping gene GAPDH.
Hsp70 mRNA was detected using specific forward .
A ACGAgTCTCAAgCAAG-3A) and .
A CTCtCTCAGCCAGCGTGTTAG-3A) primers, at 63AC for a 107 bp product (GenBank ID:
NM_031.
GAPDH was detected using forward .
A TGCACCACCAACTGCTTAGC -3A) and reverse .
A GGCATGGACTGTGGTCATGAG-3A) primers, also at 63AC for an 87 bp product (GenBank ID: NM_017.
(Macrogen.
Seoul.
Kore.
The CFX Connect real-time PCR system was used to carry out the PCR amplification (Bio-Rad Laboratories.
Hercules.
CA.
USA) in a 96-well format with a 0.
1 mL reaction volume.
Each sample was analysed in triplicate to ensure reliability and accuracy.
This study did not investigate MMP-9 mRNA expression, as an increase in MMP-9 is definitively linked to the deterioration of AIS.
AIS induction using UCAO method Day 4 Day 7 Day 10 Day 14 Motoric Function Assessment Hsp70 mRNA expression.
HSP-70.
MMP-9 and motoric function assesment 6 mg of MLC 901 Day 1 Day 2 Hsp70 mRNA expression.
HSP-70.
MMP-9 and infarct volume investgation AIS induction using UCAO method Day 4 Day 7 Day 10 Day 14 Motoric Function Assessment Hsp70 mRNA expression.
HSP-70.
MMP-9 and motoric function assesment CMC-Na Day 1 Day 2 Hsp70 mRNA expression.
HSP-70.
MMP-9 and infarct volume investgation AIS induction using UCAO method Day 4 Day 7 Day 10 Day 14 Motoric Function Assessment Hsp70 mRNA expression.
HSP-70.
MMP-9 and motoric function assesment Hsp70 mRNA expression.
HSP-70.
MMP-9 and infarct volume investgation Figure 1.
The experimental design and study timeline.
DOI: 10.
18585/inabj.
MLC 901 Decreases HSP-70.
MMP-9, and Cerebral Infarction Volume (Hunaifi I, et al.
Indones Biomed J.
: 252-62
score was subsequently analyzed.
The percentage of errors for each trial, as well as the quality of placement for both the right forelimb and hindlimb, were assessed.
Errors were classified with scores of 0, 1, and 2 .
epresenting paw slips or fall.
, and the average was calculated over five trials using the formula: .
umber of errors/number of step.
y 100, yielding the Foot Fault Score.
Error score data were presented as a percentage out of 100.
Figure 2.
Preparation of AIS rat model using UCAO technique for 180 minutes.
Measurement of Plasma Biomarker (HSP-70 and MMP-.
Using Enzyme-Linked Immunosorbent Assay
(ELISA)
ELISA was used to quantify soluble protein levels of HSP70 and MMP-9 in tail blood samples collected at baseline .
rior to stroke inductio.
, and at 24 hours .
, 48 hours .
, and 336 hours .
post-AIS.
Blood samples were processed using the Rat HSP-70 kit (Cat.
No.
LS-F37346.
LS Bio.
Seattle.
WA.
USA) and the Rat MMP-9 kit (Cat.
No.
LS-F32423.
LS Bi.
Samples were analyzed in duplicate to ensure data reliability.
ELISA
Procedure accordance with previous study.
The ELISA Reader 270 (Biomerieux.
Marcy-l'yOtoile.
Franc.
was used to measure the absorbance values in less than 30 minutes at a wavelength of 450 nm.
The concentrations of the target soluble proteins were expressed in ng/ml for HSP-70 and pg/mL for MMP-9.
Measurement of Functional Outcome (Motoric Scor.
Using Ladder Rung Walking Test The Ladder Rung Walking Test apparatus (Figure .
was utilized to evaluate neurological deficits .
otor score.
in rats at baseline .
rior to surger.
and on day-1, -2, -4, -7, -10, and -14 following AIS induction.
Each rat navigated a cylindrical staircase comprising a 1-meter pathway with rungs spaced at varying distances.
Hindlimb movements were carefully observed and recorded on video for analysis.
Rats that experienced slips were indicative of reduced or impaired motor function.
The evaluation of foot placement on the rungs was conducted using a seven-category scale, based on the nature of the errors and the positioning of the hindlimbs.
Each animal underwent five rounds of training and testing during each session.
The average error Measurement of Cerebral Infarction Volume Using Image J On day 14, all rats were euthanized.
The brains were extracted and sectioned into coronal slices using a rat brain slicer, and then immersed in a 2% solution of 2,3,5-Triphenyltetrazolium Chloride (TTC) at 37 AC for 30 Areas of infarction were identified as white regions and quantified using ImageJ software (National Institutes of Health (NIH).
Bethesda.
MD.
USA).
Statistical Analysis All data were analyzed using the Statistical Package for the Social Sciences (SPSS) version 26 (IBM Corporation.
Armonk.
NY.
USA).
The normality of the data distribution was assessed using the ShapiroAeWilk test.
Data are presented as meanAstandard deviation (SD).
The relationships among Hsp70 mRNA expression.
HSP-70 and MMP-9 levels, functional outcomes, and cerebral infarction volume were evaluated using the Spearman correlation test.
The efficacy of MLC 901 on Hsp70 mRNA expression.
HSP-70 levels, functional outcomes, and cerebral infarction volume were analyzed using a One-way ANOVA, followed by the Least Significant Difference (LSD) post hoc test.
The impact of MLC 901 on MMP-9 levels was assessed using the KruskalWallis test then Mann-Whitney post hoc test.
The result was statistically significant if p<0.
100 cm 30 cm 20 cm 5 cm for Rat 5 cm for Mice Figure 3.
Ladder rung walking test apparatus for measurement of motoric score.
The Indonesian Biomedical Journal.
Vol.
No.
June 2025, p.
AIS 43.
2 mg MLC 901 AIS 21.
6 mg MLC 901 Negative Control Cereblar Infarction Volume .
mA) Foot Fault Scroe (%) The Efficacy of MLC 901 on Hsp70 mRNA Expression The Efficacy of MLC 901 on Functional Outcome The Efficacy of MLC 901 on MMP-9 Protein MMP-9 Protein Level .
g/mL) HSP-70 Protein Level .
g/mL) The Efficacy of MLC 901 on HSP-70 Protein Efficacy of MLC 901 on Cerebral Infarction Volume Cerebral infarction volume serves as a measure of brain damage resulting from acute ischemic stroke.
Table 4 Efficacy of MLC 901 in Hsp70 mRNA Expression Within 24 h of AIS, all groups exhibited a significant increase in Hsp70 mRNA expression.
Significant differences The Efficacy of MLC 901 on Functional Outcome Motor performance scores declined following the induction of AIS.
The administration of MLC 901 significantly influenced motor performance scores among the groups from 96 h to 336 h .
<0.
(Figure 4D).
Treatment with MLC 901 at doses of 43.
2 and 21.
6 mg/200 gBW resulted in substantial improvements in motor performance scores compared to the negative control (Figure 5D).
Furthermore, on the fourth day of treatment, the 43.
2 mg/200 gBW dose demonstrated significantly greater improvement in motor performance scores compared to the 21.
6 mg/200 gBW dose (Table .
Efficacy of MLC 901 in HSP-70 and MMP-9 Protein AIS resulted in an increase in HSP-70 and MMP-9 protein levels from 24 to 336 h post-stroke compared to baseline (Figure 4A and 4B).
At 24, 48, and 336 h after MLC 901 was administered, there was a significant difference of HSP70 levels between the three groups .
<0.
Post hoc analysis results indicated that MLC 901 treatment at doses 2 and 21.
6 mg/200 gBW significantly reduced HSP-70 levels compared to the negative control.
Furthermore, the 2 mg/200 gBW dose of MLC 901 demonstrated greater efficacy in reducing HSP-70 protein levels compared to 6 mg/200 gBW dose within the 48 to 336 h posttreatment period (Table .
MMP-9 levels also exhibited significant differences between the three groups .
<0.
Administration of MLC 901 significantly reduced MMP-9 protein levels compared to the negative control.
However.
MLC 901's efficacy on lowering MMP-9 protein levels at 24, 48, and 336 h did not differ significantly between dosages of 43.
2 and 21.
6 mg/200 gBW (Table .
in Hsp70 mRNA expression levels were observed among the groups at 24, 48, and 336 h, attributed to MLC 901 administration .
<0.
(Figure 4C).
Both dosages of MLC 901 .
2 and 21.
6 mg/200 gBW) substantially decreased Hsp70 mRNA expression at 24, 48, and 336 h as compared to the negative control.
Furthermore, after 48 to 336 h, the 43.
2 mg/200 gBW dosage considerably reduced Hsp70 mRNA expression in comparison to the 21.
6 mg/200 gBW dose (Table .
mRNA Hsp70 Expression old chang.
Results Print ISSN: 2085-3297.
Online ISSN: 2355-9179
The Efficacy of MLC 901 on Cerebral Infarction Volume C
AI ML
C 90
AI ML
ga trol N on Figure 4.
The efficacy of MLC 901 based on the time after treatment.
A: HSP-70 protein.
B: MMP-9 protein.
C: Hsp70 mRNA D: functional outcome .
otoric scor.
E: cerebral infarction volume.
MLC 901 Decreases HSP-70.
MMP-9, and Cerebral Infarction Volume (Hunaifi I, et al.
Indones Biomed J.
: 252-62
DOI: 10.
18585/inabj.
Table 1.
Comparison of efficacy of MLC 901 on HSP-70 and MMP-9 protein between groups.
HSP-70
Time Group MeanASD .
g/mL) p- value 1 Baseline AIS 43.
2 mg MLC 901 66A0.
AIS 21.
6 mg MLC 901 80A0.
Negative Control 90A0.
AIS 43.
2 mg MLC 901 17A0.
AIS 21.
6 mg MLC 901 Post Hoc Test .
- valu.
MMP-9 Median (Min-Ma.
g/mL) p- value 2 08 .
40Ae1247.
Post Hoc Test .
- valu.
2 70 .
34Ae1296.
62Ae1166.
66Ae1528.
31A0.
19Ae1408.
000*,b Negative Control 70A0.
000*,b 92 .
57Ae3793.
000*,b AIS 43.
2 mg MLC 901 74A0.
AIS 21.
6 mg MLC 901 40A0.
Negative Control 10A0.
AIS 43.
2 mg MLC 901 92A0.
36Ae1247.
90Ae1263.
000*,b 000*,b 99 .
57Ae4206.
000*,b 12 .
06Ae1263.
000*,a 000*,a AIS 21.
6 mg MLC 901 04A0.
000*,b 40 .
52Ae1215.
000*,b Negative Control 21A0.
000*,b *Significant if p<0.
05, 1Analyzed with One-way ANOVA and LSD Post Hoc test, 2Analyzed with Kruskal Wallist Test and Mann Whitney Pos Hoc Test.
acompared to the AIS 21.
6 mg MLC 901 group, bcompared to the negative control group.
and Figure 4E and 5E showed that there was a significant difference between the groups in the efficacy of MLC 901 administration on cerebral infarction volume .
<0.
In comparison to the negative control, the administration of MLC 901 at dosages of 43.
2 and 21.
6 mg/200 gBW significantly decreased the cerebral infarction volume (Figure .
Furthermore, the reduction in infarction volume was significantly greater with the 43.
2 mg/200 gBW dose than with the 21.
6 mg/200 gBW dose.
Correlation between Hsp70 mRNA Expression.
HSP70 and MMP-9 Protein with Functional Outcome and Cerebral Infarction Volume The correlations between motoric score, cerebral infarction volume.
Hsp70 mRNA expression, and HSP-70 and MMP-9 protein levels are shown in Table 5.
Hsp70 mRNA expression demonstrated a significant negative correlation with motor performance scores .
=-0.
p<0.
and a positive correlation with cerebral infarction Table 2.
Comparison of the efficacy of MLC 901 on Hsp70 mRNA expression .
Time Baseline MeanASD (Fold Chang.
p- value 1 AIS 43.
2 mg MLC 901 98A0.
AIS 21.
6 mg MLC 901 74A0.
Group Post Hoc Test .
- valu.
2 Negative Control 61A0.
AIS 43.
2 mg MLC 901 60A0.
AIS 21.
6 mg MLC 901 83A0.
000* ,b Negative Control 77A0.
000* ,b AIS 43.
2 mg MLC 901 83A0.
AIS 21.
6 mg MLC 901 91A0.
000*,b Negative Control 42A0.
000*,b AIS 43.
2 mg MLC 901 87A0.
AIS 21.
6 mg MLC 901 69A0.
000*,b Negative Control 61A0.
000*,b 000*,a 000*,a *Significant if p<0.
05, 1Analyzed with One-way ANOVA and LSD Post Hoc test.
Analyzed with Kruskal Wallist Test and Mann Whitney Pos Hoc Test.
acompared to the AIS 21.
6 mg MLC 901 group, bcompared to the negative control group.
The Indonesian Biomedical Journal.
Vol.
No.
June 2025, p.
Functional Outcome (%) HSP-70 .
g/mL) Cerebral Infarction Volume .
mA) Hsp70 mRNA Expression (Fold Chang.
MMP-9 .
g/mL) Print ISSN: 2085-3297.
Online ISSN: 2355-9179 AIS 43.
2 mg MLC 901 AIS 21.
6 mg MLC 901 Negative control Figure 5.
The meanASD of each parameters between A: HSP-70 protein.
B: MMP-9 protein.
Hsp70 mRNA expression.
D: functional outcome .
otoric scor.
E: cerebral infarction volume.
=0.
803, p<0.
Additionally.
HSP-70 and MMP-9 protein levels showed strong negative correlations with motor performance scores .
=-0.
926, p<0.
001 and r=-0.
631, p=0.
001, respectivel.
and positive correlations with cerebral infarction volume .
=0.
717, p<0.
001 and r= 473, p<0.
001, respectivel.
These findings indicate that Table 3.
Comparison of efficacy of MLC 901 on functional outcome .
otoric scor.
between Time Baseline Post Hoc Test MeanASD (Percentag.
p -value 1 AIS 43.
2 mg MLC 901 95A1.
AIS 21.
6 mg MLC 901 81A0.
Negative Control 41A1.
AIS 43.
2 mg MLC 901 27A1.
AIS 21.
6 mg MLC 901 38A1.
Negative Control 48A0.
AIS 43.
2 mg MLC 901 19A3.
AIS 21.
6 mg MLC 901 32A1.
Negative Control 23A0.
AIS 43.
2 mg MLC 901 00A0.
AIS 21.
6 mg MLC 901 38A0.
Negative Control 61A2.
030*,b AIS 43.
2 mg MLC 901 15A1.
AIS 21.
6 mg MLC 901 92A1.
Negative Control 92A1.
AIS 43.
2 mg MLC 901 89A0.
AIS 21.
6 mg MLC 901 97A0.
Negative Control 68A1.
001*,b AIS 43.
2 mg MLC 901 69A1.
AIS 21.
6 mg MLC 901 33A0.
000*,b Negative Control 59A0.
Group .
- valu.
001*,a 000*,a *Significant if p<0.
05, 1Analyzed with One-way ANOVA, 2Analyzed with LSD Post Hoc test.
MLC 901 Decreases HSP-70.
MMP-9, and Cerebral Infarction Volume (Hunaifi I, et al.
Indones Biomed J.
: 252-62
DOI: 10.
18585/inabj.
AIS 43.
2 mg MLC 901 AIS 21.
6 mg MLC 901 Negative Control Figure 6.
Brain coronal slice using TTC staining.
Administration of MCL 901 indicate reduce cerebral infarction volume compared to the negative control.
White arrow: cerebral infarction.
in Wistar rats subjected to an AIS model, elevated Hsp70 mRNA expression and increased levels of HSP70 and MMP-9 proteins were associated with the larger cerebral infarction volumes and more severe neurological Discussion Cerebral ischemia triggers an rise in HSP-70 levels through the activation of heat shock proteins and their associated transcription factors (HSP-HSF.
, which boost HSP mRNA transcription and translation.
This research revealed a notable increase in Hsp70 mRNA expression and protein concentrations 24 to 48 h after acute ischemic stroke.
HSP70 serves dual purposes: within cells, it inhibits apoptosis, while outside cells, it promotes the release of inflammatory An imbalance between these intracellular and extracellular forms may contribute to insulin resistance in patients with type 2 diabetes mellitus and other chronic The extracellular form acts as a damageassociated molecular pattern (DAMP), stimulating the release of pro-inflammatory mediators via TLR 2/4 mediated by MyD88.
The outcomes of patients with brain injuries are affected by variations in their elevated HSP-70 levels.
Table 4.
Comparison of efficacy of MLC 901 on cerebral infarction volume between groups.
Post Hoc Test Group MeanASD .
p -value 1 AIS 43.
2 mg MLC 901 86A0.
AIS 21.
6 mg MLC 901 75A2.
000*,b 28A1.
000*,b Negative Control .
- valu.
2 000*,a *Significant if p<0.
Analyzed with One-way ANOVA.
Analyzed with LSD Post Hoc test.
The atherosclerosis is significantly affected by Within the vascular wall, inflammatory processes initiate the release of proinflammatory mediators and increase the expression of intercellular adhesion molecules (ICAM-.
and vascular cell adhesion molecules (VCAM)-1 and VCAM-3, ultimately inducing HSP70 expression.
While low levels of HSP-70 hasten atherosclerosis progression, elevated levels are linked to arterial fat accumulation, promoting the formation of atherosclerotic lesions and increasing the risk of acute coronary syndrome.
The current study demonstrated that MLC 901 administration markedly reduced HSP-70 levels in comparison with the negative control.
Similarly.
AST-IV inhibits HSP expression.
Sustained elevation of HSP-70 levels beyond 24 h is associated with unfavorable outcomes in patients with severe traumatic brain injury or cardiac arrest.
The higher dose of 43.
2 mg/200 gBW of MLC 901 indicated a high level of AST-IV, which could reduce the HSP-70 better than the lower dose of 21.
mg/200 gBW.
Within 24 to 48 h following ischemia, rats that have experienced a stroke show considerable expression of HSP-70 in brain neurons, the penumbra, and circulation.
Overexpression of extracellular HSP-70 activates the NF-B pathway, leading to the generation of proinflammatory cytokines such as IL-6, inducible nitric oxide synthase .
NOS), and IL-1 through interactions with CD14 molecules and TLR 2/4.
Neural cells may be damaged by the excessive and sustained production of inflammatory Moreover, oxidative stress causes an increase in reactive oxygen species (ROS) concentrations, which damages the mitochondria.
MLC 901 contains quercetin, an HSP-70 inhibitor that suppresses Heat shock factor protein (HSF)1 expression, reduces HSP70 accumulation, and promotes cancer cells.
Chronic stressors, such as hypertension, increase HSP-70 expression and trigger the release of inflammatory markers, including The Indonesian Biomedical Journal.
Vol.
No.
June 2025, p.
Print ISSN: 2085-3297.
Online ISSN: 2355-9179 Table 5.
Correlation between Hsp70 mRNA expression.
HSP-70 and MMP-9 protein with cerebral infarction volume and functional outcome.
Parameters Functional Outcome Cerebral Infaction Volume p- value p- value Hsp70 mRNA Expression HSP-70 Protein MMP-9 Protein *Significant if p<0.
Analyzed with SpearmanAos Correlation test.
This leads to elevated C-reactive protein (CRP) levels, proliferation of vascular smooth muscle cells, and advancement of atherosclerosis.
MMP-9 is an indicator of blood-brain barrier damage.
High levels of MMP-9 result in severe neurovascular tissue damage, causing hemorrhagic transformation and brain MMP-9 concentrations exceeding 100 ng/mL are associated with severe cerebral oedema and haemorrhagic Furthermore, in patients with a modified Rankin Scale .
RS) score >3, elevated MMP-9 levels were notably associated with poor outcomes three months after stroke.
Milder stroke consequences are observed with lower MMP-9 levels and are related to the stroke .
In this study.
MMP-9 concentrations peaked at 24 h post-stroke onset and were considerably reduced by MLC 901 treatment.
The TMP component in MLC 901 suppressed TNF- levels, caspase-3 expression.
TLR-4/NFB expression, and MMP-9 and AQP4 expression.
HSYA
enhances tissue inhibitor of metalloproteinases (TIMP)-1, which decreases MMP-9 expression 1.
Seneginin of MLC 901 further minimizes cellular damage by lowering MMP levels.
ROS, and apoptosis.
AST-IV also inhibits MMP-9 and Aquaporin 4 levels, thereby diminishing postischemic cerebral oedema.
Treatment with MLC 901 led to notable improvements in neurological deficits from the 14th to the 14th day of administration when juxtaposed with the negative control group.
Further analysis revealed that a dosage of 43.
2 mg/200 gBW of MLC 901 yielded better neurological outcomes compared to a 21.
6 mg/200 gBW Research on ischemic stroke models has demonstrated that MLC 901 constituents, including ferulic acid.
AST-IV, -asarone, and TSB, can alleviate neurological impairment, reduce cerebral infarct size, decrease blood-brain barrier permeability, and mitigate neurological damage.
This study indicates that the MLC 901 treatment improved neurological outcomes in ischemic stroke models from 4th day .
of administration.
In AIS, the extent of cerebral infarction is indicative of neuronal damage, and plays a crucial role in evaluating the effectiveness of therapeutic interventions.
Results of this study revealed that MLC 901 substantially reduced cerebral infarction volume compared to that in the negative control group.
MLC 901 comprises active ingredients, such as ligustilide, 3-n-butylphthalide, and ferulic acid, which exhibit anti-inflammatory, neurogenic, angiogenic, and antiatherosclerotic properties, thus improving neurological deficits and diminishing cerebral infarction volume.
Moreover.
AST-IV.
TSB, and -asarone also contribute to the amelioration of neurological deficits and reduction of cerebral infarction volume.
This research revealed a significant link between Hsp70 mRNA expression.
HSP-70 protein levels, and MMP9 with the volume of cerebral infarction and neurological Elevated Hsp70 mRNA expression was associated with the intensity of head trauma.
MMP-9
exhibits a strong connection with cerebral infarction size in ischemic stroke models.
Both HSP-70 and MMP-9 play crucial roles in various pathological mechanisms involved in cerebral ischaemia.
The strength of this study lies in its pioneering investigation of the efficacy of MLC 901 on Hsp70 mRNA expression and HSP-70 protein levels.
Moreover.
MLC 901 enhances neurological function, elevates MMP-9 protein levels, and diminishes cerebral infarction volume in AIS models.
The study also identified the appropriate MLC 901 dosages that could benefit patients with AIS.
Nevertheless, the research is constrained by its failure to analyze Hsp70 mRNA in brain tissue and the omission of neural regeneration markers, such as synaptophysin and brain-derived neurotrophic factor (BDNF).
Calcineurin (CaN).
Future studies should focus on analyzing mRNA expression in brain tissue and evaluating neural regeneration markers through histopathological analysis and neuronal regeneration biomarkers.
DOI: 10.
18585/inabj.
MLC 901 Decreases HSP-70.
MMP-9, and Cerebral Infarction Volume (Hunaifi I, et al.
Indones Biomed J.
: 252-62
Conclusion In this rat model of AIS.
MLC 901 treatment significantly reduced Hsp70 mRNA expression.
HSP-70 and MMP9 protein levels, and cerebral infarction volume, while also significantly improving functional outcomes .
otor score.
compared to the control group.
The 43.
2 mg/200 gBW dose of MLC 901 was generally more effective than 6 mg/200 g dose in reducing Hsp70 mRNA and protein levels, decreasing infarct volume, and improving functional recovery.
These findings suggest that MLC 901 in concentration-dependent manner may have potential neuroprotective effects in AIS.
Acknowledgments We thank to all staff at the Molecular Biology and Immunology Laboratory Department of Microbiology.
Faculty of Medicine.
Universitas Hasanuddin University, as well as staff at Faculty of Medicine and Health Sciences.
Universitas Mataram for all their support during the study.
Authors Contribution All authors were involved in concepting and planning the research.
IH.
AKB.
JT, and IW performed the data acquisition/collection and calculated the experimental data and all authors performed the analysis.
All authors took parts in drafted the manuscript and designed the figures, aided in interpreting the results, and giving critical revision of the manuscript.
References